Характеристики грунтов: Физические свойства грунтов

Автор

Содержание

Характеристика грунтов

Комнатные печи и огневые очаги массой до 750 кг устанавливают непосредственно на полу, если он достаточно прочен. Массу печи легко определить, зная, что 1 м кладки (включая пустоты) весит приблизительно 1600 кг. Если пол первого этажа недостаточно прочен, его необходимо усилить дополнительными опорами на кирпичных столбиках, а пол второго этажа — дополнительными балками. Печные устройства массой более 750 кг сооружаются на фундаментах или на специальных конструкциях. Фундамент должен опираться на плотный грунт.

Не все грунты могут служить основанием для устройства фундаментов, печей. Наиболее прочными и надежными грунтами считаются скальные, полускальные, крупнообломочные, а также песчаные и глинистые.

Скальные грунты — сплошные прочные породы (например, гранит) и некоторые осадочные породы (известняки, песчаники). Эти грунты отличаются большим сопротивлением сжатию и стойкостью против действия грунтовых вод и низких температур. Такими же свойствами обладают и полускальные грунты — окремнейные глины и мергели.

Крупнообломочные грунты представляют собой обломки скальных пород и называются Щебнем и дресвой. Они имеют острые и рваные края в противоположность обкатанным краям более измельченных гальки и гравия. Галька отличается от гравия своими размерами: размеры кусков гальки превышают 15 мм, размеры кусков гравия от 5 до 15 мм.

Песчаные грунты также достаточно плотные и прочные для устройства на них оснований под фундаменты печей.

Глинистые грунты в зависимости от содержания в них глины подразделяются на чисто глинистые, суглинки и пески.

Глина редко встречается в природе в чистом, виде. Если в высушенном грунте содержится более 25 % глины, то такой грунт называется глинистым. При содержании в грунте глины в смеси с песком в количестве 12...25 % грунт называется суглинком; при 3...12 % .— супесью.

Все перечисленные виды глинистых грунтов являются достаточно прочным основанием для печи. Наряду с ними встречаются так называемые макропористые грунты, также содержащие глину, но имеющие крупные поры, отчетливо видимые простым глазом. Большое количество крупных пор ведет к тому, что при попадании в них воды эти грунты легко разжижаются и теряют свою прочность.Такие грунты нужно защищать от попадания в них как грунтовых, так и поверхностных вод.

При выравнивании строительных площадок под сооружаемое здание отдельные котлованы иногда засыпают грунтом Так образуются насыпные грунты, которые отличаются большой рыхлостью и неопределенностью состава. При устройстве фундаментов печей на таких грунтах их необходимо предварительно уплотнять.

Нижняя плоскость фундамента, опирающаяся непосредственно на грунт, называется подошвой фундамента. Для одноэтажных печей без насадных труб подошву фундамента заглубляют в грунт не менее чем на 0,5...0,6 м, для коренных труб и одноэтажных печей Фасадными трубами — на 0,75 м и для двухэтажных печей, н коренных труб на 1 м.

Физические свойства грунтов и их характеристики

Вернуться на страницу «Основания фундаментов»

Физические свойства грунтов и их характеристики

Все грунты отличаются между собой многими признаками. Для механики грунтов наиболее важными являются их физические и механические свойства, количественные показатели свойств грунтов называют характеристиками. Характеристики физических свойств условно разделяют на группы:

основные и производные. К основным характеристикам относятся: плотность твердых частиц, плотность грунта природного сложения и влажности. Их определяют опытным путем в лаборатории или в полевых условиях. К производным относят: плотность сухого грунта (Скелета), пористость, коэффициент пористости и коэффициент водонасыщения. Их вычисляют по формулам, используя основные характеристики.

Рис.1. Определение характеристик грунтов.

В состав взятого объема V грунтов входят: твердые частицы суммарным объемом Vs и массой ms, а также полости между ними с объемом Vp. При этом поры могут быть заполнены частично воздухом с объемом Va и частично водой объемом Vw с массой mw.

Плотностью твердых частиц грунта называют массу единицы объема твердых частиц, составленных абсолютно плотно, то есть без каких-либо зазоров, и пор между ними. Плотность твердых частиц выражают отношением массыm

s твердых частиц, содержащихся в общем объеме V почвы, к их суммарному объемуVs:

ps= ms/Vs

За единицу измерения плотности твердых частиц грунта используют г / см3. Определяют эту характеристику зачастую пикнометрическим методом. При этом массу твердых частиц находят взвешиванием образца грунта, предварительно высушенного до постоянной массы при температуре 100 … 1050С, а объем твердых частиц определяют по массе, вытесненной им жидкости с известной плотностью, с помощью специальных мерных колб (так называемых Пикнометры).

Величина плотности твердых частиц почвы зависит только от их минералогического состава. Она возрастает при увеличении содержания в почве и плотности породо-образовательных минералов (кварца, каолинита, ортоклаза, плагиоклаза, биотита,мусковита и т.п.), а уменьшается — при увеличении содержания органических веществ.

Средние значения плотности твердых частиц отдельных типов дисперсных грунтов составляют: песков — 2,65 … 2,67; супесей — 2,68 … 2,72; суглинков — 2,69 … 2,73;глин — 2,71 … 2,76; заторфованных грунтов — 2,0 … 2,2; торфов — 1,4 … 1,8 г / см3.

Плотностью грунта природной (ненарушенной) структурой называют массу единицы его объема и выражают отношением массы грунта m, включая массу твердых частиц ms и массу воды mw, к общему объему почвы V, включая объем твердых частиц Vs и объем пустот Vp:

p = m/V = (ms + mw)/(Vs + Vp)

Соответственно плотность грунта измеряют в г / см3. Для определения плотности грунтов могут быть применены несколько методов:

— метод режущего кольца (Для грунтов, которые легко поддаются обработке ножом), метод парафинирования,

— метод гидростатического взвешивания в нейтральной жидкости — бензине, керосине, и т. п. (для скальных и мерзлыхпочв).

Величина плотности зависит от минералогического состава, влажности и пористости (плотности строения) грунта. Почвы одинакового состава и строения имеют наибольшую массу в случае полного заполнения пор водой. Величина плотности глин, суглинков, супесей, песков и крупнообломочных грунтов находится в диапазоне от 1,2 до 2,4 г / см

3. Более высокие значения плотности относятся к крупнообломочным (разнозернистым) грунтам, моренным суглинкам и глин. Меньшее значение плотности характерны для грунтов, содержащих гумус, или для лессовых грунтов. Плотность сухого торфа может быть меньше 1,0 г / см3.

Влажностью грунта W называют относительное количество воды, содержащейся в его полостях. В механике грунтов пользуются, так называемой, абсолютной (весовой) влажностью. Абсолютную влажность выражают отношением массы mводы, содержащейся в порах некоторого объема грунта V, к массе ms твердых частиц, содержащиеся в этом же объеме. Влажность почвы измеряют в относительных единицах (г / г) или в процентах, то есть

W = mw / ms = ( m – ms)/ms

W = (mw / ms)100% = [( m – ms)/ms]100%

В дальнейшем весовую влажность будем называть просто влажностью. Ее величина изменяется в очень широких пределах, достигая 200% и более (например, в текучих глинах, морских и речных илах). Влажность определяют высушиванием грунта до постоянной массы при температуре 100 … 1050С. Грунт, высушенный до постоянной массы, называют абсолютно сухим.

 

Механические свойства грунтов

Механические свойства грунтов - свойства грунтов, проявляющиеся при приложении к ним нагрузок. Различают прочностные и деформационные свойства.

Для расчетов деформаций, устойчивости грунта и оценки прочности оснований необходимо знать механические характеристики используемых грунтов. Такими свойствами определяется поведение грунтовых массивов под воздействием нагрузок и при изменении их физического состояния. На механические свойства оказывают влияние характер структурных связей частиц, гранулометрический и минеральный состав и влажность грунтов. Основными механическими свойствами грунтов считают: сжимаемость; сопротивление сдвигу; водопроницаемость.

Способность грунта уменьшаться в объеме под воздействием уплотняющих нагрузок называют сжимаемостью, осадкой или деформацией. По физическому строению грунт состоит из отдельных частиц различной крупности и минерального состава (скелет грунта) и пор, заполненных жидкостью (вода) и газом (воздух). Частицы в грунте бывают связанные и несвязанные между собой, но независимо от этого, прочность связей всегда ниже прочности частиц. При возникновении напряжений сжатия изменение объемов происходит за счет уменьшения объемов, располагающихся внутри грунта пор, заполненных водой или воздухом и за счет сгущения связующих (коллоидов). Таким образом, сжимаемость зависит от многих факторов, основными из которых являются физический состав, вид структурных связей частиц и величина нагрузки.
По характеру усадки разделяют упругие и пластические деформации. Упругие деформации возникают в результате нагрузок, не превышающих структурную прочность грунтов, т.е. не разрушающих структурные связи между частицами и характеризуются способностью грунта возвращаться в исходное состояние после снятия нагрузок. Пластические деформации разрушают скелет грунта, нарушая связи и перемещая частицы относительно друг друга. При этом объемные пластические деформации уплотняют грунт за счет изменения объема внутренних пор, а сдвиговые пластические деформации – за счет изменения его первоначальной формы и вплоть до разрушения. При расчетах сжимаемости грунта основные деформационные характеристики определяют в лабораторных условиях согласно коэффициенту относительной сжимаемости, коэффициенту бокового давления и коэффициенту поперечного расширения.

Сопротивление сдвигу. Прочность грунта.
Предельным сопротивлением сдвигу (растяжению) называется способность грунта противостоять перемещению частей грунта относительно друг друга под воздействием касательных и прямых напряжений. Этот показатель характеризуется прочностными свойствами грунтов и используется в расчетах оснований зданий и сооружений. Способность грунта воспринимать нагрузки не разрушаясь, называют прочностью. В песчаных и крупнообломочных несвязных грунтах сопротивление достигается в основном за счет силы трения отдельных частиц, такие грунты называют сыпучими. Глинистые грунты обладают более высоким сопротивлением к растяжению (сдвигу), т.к. наряду с силой трения сдвигу противостоят силы сцепления: водно-коллоидные и цементационные связи (связные грунты). В строительстве этот показатель важен при расчете оснований фундаментов и изготовлении земляных сооружений с откосами.
Водопроницаемость грунтов.
Водопроницаемость характеризуется способностью грунта пропускать через себя воду под действием разности напоров и обуславливается физическим строением и составом грунта. При прочих равных условиях при физическом строении с меньшим содержанием пор, и при преобладании в составе частиц глины водопроницаемость будет меньшей, нежели у пористых и песчаных грунтов соответственно. Нельзя недооценивать данный показатель, т.к. в строительстве он влияет на устойчивость земляных сооружений и обуславливает скорость уплотнения грунтов оснований, суффозию грунта и оползневые явления (в т.ч. и на сопротивление растяжению). Фильтрацией называется движение свободно-гравитационной воды в грунтах в различных направлениях (горизонтально, вертикально вниз и вверх) под воздействием гидравлического градиента (уклона, равного потере напора на пути движения) напора. Коэффициентом фильтрации (Kf) принято считать скорость фильтрации при гидравлическом градиенте равном единице. При этом скорость фильтрации (V) прямо пропорциональна гидравлическому градиенту (J). V = Kf * J.

1.2. Физические свойства грунтов

Вы здесь

Библиотека / Сорочан Е. А. Основания, фундаменты и подземные сооружения / Глава 1. Свойства грунтов

Сообщение об ошибке

Strict warning: Only variables should be passed by reference в функции duble_node() (строка 191 в файле /home/s/seryis/ofips.rf/public_html/sites/all/themes/adaptivetheme/at_ofips/template.php).

1.2.1. Характеристики плотности грунтов и плотности их сложения

Одной из основных характеристик грунта является плотность. Для грунтов различают: плотность частиц грунта ρs — отношение массы сухого грунта (исключая массу воды в его порах) к объему твердой части этого грунта; плотность грунта ρ — отношение массы грунта (включая массу воды в порах) к занимаемому этим грунтом объему; плотность сухого грунта ρd — отношение массы сухого грунта (исключая массу воды в его порах) к занимаемому этим грунтом объему (включая имеющиеся в этом грунте поры). Плотность частиц песчаных и пылевато-глинистых грунтов приведена в табл. 1.2.

ТАБЛИЦА 1.2. ПЛОТНОСТЬ ЧАСТИЦ ρs ПЕСЧАНЫХ И ПЫЛЕВАТО-ГЛИНИСТЫХ ГРУНТОВ

Грунт ρs, г/см3
диапазон средняя
Песок 2,65—2,67 2,66
Супесь 2,68—2,72 2,70
Суглинок 2,69—2,73 2,71
Глина 2,71—2,76 2,74

Плотность грунта определяется путем отбора проб грунта ненарушенного сложения и последующего анализа в лабораторных условиях. В полевых условиях плотность грунта определяется зондированием и радиоизотопным методом, а для крупнообломочных грунтов — методом «шурфа–лунки».

Плотность сложения грунта (степень уплотненности) характеризуется пористостью n или коэффициентом пористости е и плотностью сухого грунта (табл.  1.3).

ТАБЛИЦА 1.3. РАСЧЕТНЫЕ ФОРМУЛЫ ОСНОВНЫХ ФИЗИЧЕСКИХ ХАРАКТЕРИСТИК ГРУНТОВ

Характеристики Формула
Плотность сухого грунта, г/см3 (т/м3) ρd = ρ/(1 + w)
Пористость % n = (1 – ρd /ρs)100
Коэффициент пористости e = n/(100 – n) или e = (ρs – ρd)/ρd
Полная влагоемкость ω0 = eρw /ρs
Степень влажности
Число пластичности Ip = ωL – ωp
Показатель текучести IL = (ω – ωp)/(ωL – ωp)

Плотность сложения песчаных грунтов определяется также в полевых условиях с помощью статического и динамического зондирования.

1.2.2. Влажность грунтов и характеристики пластичности пылевато-глинистых грунтов

Влажность грунтов определяют высушиванием пробы грунта при температуре 105°С до постоянной массы. Отношение разности масс пробы до и после высушивания к массе абсолютно сухого грунта дает значение влажности, выражаемое в процентах или долях единицы. Долю заполнения пор грунта водой — степень влажности Sr рассчитывают по формуле (см. табл. 1.3). Влажность песчаных грунтов (за исключением пылеватых) изменяется в небольших пределах и практически не влияет на прочностные и деформационные свойства этих грунтов.

Характеристики пластичности пылевато-глинистых грунтов — это влажности на границах текучести ωL и раскатывания ωp, определяемые в лабораторных условиях, а также число пластичности Ip и показатель текучести IL вычисляемые по формулам (см. табл. 1.3). Характеристики ωL, ωp и Iр являются косвенными показателями состава (гранулометрического и минералогического) пылевато-глинистых грунтов. Высокие значения этих характеристик свойственны грунтам с большим содержанием глинистых частиц, а также грунтам, в минералогический состав которых входит монтмориллонит.

Сорочан Е.А. Основания, фундаменты и подземные сооружения

19 - Характеристика грунтов - СтудИзба

Тема: Характеристика грунтов. Классификация. Физико-механические свойства грунтов.

1.                   Характеристика грунтов.

2.                   Влияние состава, структуры, текстуры и состояния грунтов на их свойства.

3.                   Инженерно-геологическая классификация грунтов.

4.                   Механические свойства грунтов.

1. Характеристика грунтов.

а) Крупнообломочные и песчаные грунты характеризуются хорошей водопроницаемостью, отсутствием капиллярности. Применяют как дренирующий материал, как заполнитель в бетоне. Не обладают связностью и не набухают. Усадка, пластичность и липкость отсутствуют. Имеют высокий Кб, поэтому, если оросительные каналы проходят в таких грунтах,

Рекомендуемые файлы

FREE

Учебный план для ИУ3, ИУ4, ИУ5, ИУ6, ИУ7, РК 6, РЛ6, МТ4, МТ8, МТ11, СМ13

Физика

Ответы на сертификацию Google Рекламы по проведению кампаний для приложений 2021 Август

Информатика, программирование

-60%

Решенные все 35 билетов 2021 (теории + задач)

Физика

FREE

Голицынский. Грамматика. Сборник упражнений. (7-е издание) (2011)

Английский язык

FREE

Информатика и системы управления (бакалавриат)

Вспомогательные материалы для первокурсников

-15%

Ответы на теорию при поступлении в магистратуру МТ-11

Поступление в магистратуру

обязательно предусматривают противофильтрационные устройства. Применяют гравийно-песчаную подготовку при устройстве ж/б сооружений.

б)    Песчаные пылеватые грунты в сухом состоянии также не связны. При увлажнении переходят в плывунное состояние. Как дренирующий материал мало пригодны.

в)     Супесчаные легкие грунты характеризуются относительно благоприятными свойствами при использовании в качестве материла проезжей части грунтовых дорог и в основании дорожных покрытий. Они не пластичны или мало пластичны. В сухом состоянии обладают достаточной связностью; пылеобразование не значительно, быстро просыхают, не набухают и не обладают липкостью. Эти грунты устойчивы в сухом и во влажном состоянии, т.к. сочетают положительные стороны песчаных (большое внутреннее трение и хорошую водопроницаемость) и глинистых (связность в сухом состоянии) частиц.

г)     Супесчаные пылеватые грунты характеризуются преобладанием пылеватых частиц. В сухом состоянии мало связны, сильно пылят. Довольно быстро и на большую высоту поднимают воду капилляром (до 3 м), что в ряде случаев способствует образованию пучин на дорогах. Обладают малой пластичностью и плохой водопроницаемостью. В дорожном отношении весьма не благоприятны.

д)    Суглинистые. Отличаются связностью и незначительной водопроницаемостью. Для них характерны пластичность, липкость, набухание, влагоемкость и капиллярность. Тяжелосуглинистые трудно поддаются разработке. Медленно просыхают после увлажнения.

е)     Глины. Характеризуются большой плотностью и связностью. Практически водопроницаемы и трудно поддаются разработке. Обладают большой пластичностью, липкостью и набуханием. Капиллярные свойства выражены в меньшей степени, чем в суглинистых и пылеватых грунтах. Недостаточно устойчивы под нагрузкой. При насыщении водой она ее удерживает длительное время.

Гранулометрический состав грунтов является хотя и очень важным, но не единственным признаком по которому можно судить об устойчивости грунтов под сооружениями или о применении ее как стройматериала. Для более полной и правильной оценки свойств грунтов необходимо учитывать их генезис, минералогический и химический состав, физическое состояние и другие особенности.

2. Влияние состава, структуры, текстуры и состояния грунтов на их свойства.

При визуальном осмотре, а особенно при разработке грунтов очень часто можно обнаружить, что они распадаются на разные по форме и величине отдельности, называемые структурными агрегатами. Понятие о структуре и структурных связях существенно дополняет представление о грунтах, как дисперсных системах.

Под термином «структура грунта» Е.М. Сергеев предлагает понимать размер, форму, характер поверхности, количественное соотношение слагающих грунт элементов (отдельных частиц и агрегатов цемента). Пространственное расположение элементов, слагающих грунт, независимо от их размера принято называть текстурой грунта.

Применительно к грунта в понятие «структура» включен еще и такой фактор, определяющий свойства грунтов, как способ взаимосвязи элементов, слагающих грунт, или так называемые структурные связи.

По современным представлениям структурные связи в грунтах имеют преимущественно электрическую природу. Они формируются в течение всего периода образования грунта и последующего периода его существования в земной коре. Те связи, которые формируются при формировании самого грунта, называются первичными. В магматических породах они возникают в результате остывания магмы, в метаморфических - перекристаллизации исходных пород, в осадочных - в результате процессов диагенеза осадков.

По прочности структурные связи могут быть самыми различными: от очень прочных, соизмеримых по прочности с ионными и ковалентными связями (в минералах), до очень слабых, существование которых почти не влияет на свойства грунтов.

В магматических, большей части метаморфических и части осадочных горных пород имеет место химическая связь. Она является наиболее прочным типом структурной связи. В основе ее лежат электрические силы взаимодействия между атомами. Химические структурные связи могу быть кристаллизационными и твердыми аморфными. Кристаллизационные связи являются наиболее прочными. Грунты с химическими структурными связями отличаются высокой прочностью, слабой сжимаемостью и упругостью в определенном диапазоне нагрузок. При больших определенных для каждого грунта нагрузках грунты разрушаются и химические связи в них не восстанавливаются.

В грунтах тонкодисперсных осадочного происхождения (глинистых и пылеватых) проявляется молекулярная и молекулярно-ионно- электростатическая связь. Молекулярная связь существует между твердыми телами, молекулами атомами и ионами, т.е. является универсальной. Она значительно слабее химической, но проявляется при значительно большем расстоянии между частицами. Количество молекулярных взаимодействий возрастает с увеличением в грунте отдельных поверхностей, т.е. степени дисперсности. Лучше всего молекулярная связь проявляется в высушенных глинистых грунтах.

При увлажнении глинистых грунтов вокруг частиц и между частицами образуется гидратная оболочка и диффузный слой ионов. Вследствие этого между дисперсными частицами проявляются с одной стороны, молекулярные силы притяжения, а с другой - ионно- электростатические силы отталкивания. Результирующая этих сил и будет определять прочность структурных связей в дисперсных грунтах. Такие структурные связи называют молекулярно-ионно-статическими, или водноколлоидные. Водноколлоидные связи характерны для глинистых грунтов. Прочность этих связей уменьшается с увеличением влажности грунта. Водноколлоидные связи менее прочные в сравнении с кристаллизационными и твердыми аморфными.

В одних и тех же грунтах может быть один тип связей, а может быть два и более (смешанные связи). Разделение грунтов по структурным связям не всегда можно четко провести: ряд грунтов, имея смешанный состав, обладают и некоторыми промежуточными свойствами. Например, такие породы как суглинки, лесс и др. имеют смешанные связи.

Прочность связей в одних грунтах во всех направлениях одинакова (изотропные грунты), а в других она изменяется по отдельным направлениям (анизотропные грунты).

Структура грунтов кристаллизационными связями при одинаковом минеральном составе определяет степень устойчивости их при выветривании; мелкокристаллические грунты разрушаются в меньшей степени, чем крупнокристаллические. Осадочные крупнообломочные грунты на сжатие более прочны, чем мелкозернистые.

Применительно к пылеватым (лессы) и глинистым грунтам в грунтоведении структура породы делится на макро-, мезо- и микроструктуру. Макроструктур характеризует особенности структуры грунта по структурным элементам, видимым невооруженным глазом (зернам, чешуйкам). Размер структурных элементов может изменяться от метра и более до долей сантиметра. Мезоструктура определяется структурными элементами от нескольких мм до тысячных его долей. Она может изучаться или с помощью лупы или под микроскопом с увеличением до 500 - 600 раз. Микроструктура характеризуется элементарными частицами размером менее 1-5 микронов. Поэтому она изучается с помощью электронного микроскопа при увеличении в несколько тысяч раз.

Текстура грунтов характеризует пространственное расположение элементов-частиц, кристаллов, цемента, и плотность их сложения. Текстура грунтов оказывает большое влияние на их свойства. Наиболее прочные грунты обычно имеют плотную массивную текстуру (большая часть магматических горных пород, некоторые метаморфические и осадочные горные породы). Пористые грунты обычно наименее прочны.

3. Инженерно-геологи ческая классификация грунтов.

Общепринятым признаком подразделения горных пород является характер внутренних связей между частицами в породах. По классификации Н.Н. Маслова, отчасти сходной с классификациями Ф.П. Саваренского и В.А. Приклонского выделяют 4 класса пород:

1.     Породы с превалирующей ролью жестких структурных

связей - скальные (жестки) породы (магматические и метаморфические) и осадочные (сцементированные и отвердевшие).

2.                                Глинистые породы с внутренними связями, главным образом молекулярного, ионно-электростатического и капиллярного характера - аргиллиты, алевриты, мергелистые и оконовидные глины, суглинки и супеси.

3.                                Породы без внутренних связей - рыхлые, обломочные и песчаные породы.

4.                                Породы, отличающиеся по своим связям особыми свойствами - особые породы. Каждый из первых трех классов пород делится на 2 категории: 1) водостойкие, 2) водонестойкие. Водостойкость скальных и сыпучих пород определяется их стойкостью против растворения (выщелачивания), степень гидростойкости глинистых пород той или иной способностью размягчаться в воде. Дальнейшее деление категорий пород сделано по их происхождению и другим признакам. Породы первого класса характеризуются высокой механической прочностью, практически несжимаемы, водопроницаемы по трещинам, невлагоемкие, держат вертикальные откосы. Второй класс - глинистым породам свойственна слабая водопроницаемость, влагоемкость, сжимаемость под нагрузкой, причем сжатие нередко происходи в течение длительного периода. Прочность повышается с увеличением влажности. В сухом состоянии могут держать вертикальные откосы. Породы 3 класса хорошо водопроницаемые, невлагоемкие, несжимаемые, за исключением слабоуплотненных разностей, причем сжатие под нагрузкой происходит быстро. Угол устойчивого откоса, зависящий от сил трения, обычно равен 30° - 40°. Форма откоса прямолинейная.

5.                                К особым породам отнесены торф, почвы, многолетне- мерзлые породы, «культурные» отложения, илы, плывуны, пески и др. При использовании этих пород в качестве оснований в каждом отдельном случае требуется особый подход. Особенности плывунов мы будем рассматривать отдельным вопросом на следующих уроках.

4. Механические свойства грунтов.

Под действием внешних сил (давление от веса сооружений и т.п.) в рыхлых нескальных горных породах возникают как общие деформации, присущие всем сплошным телам, так и деформации, обусловленные перемещением минеральных частичек, слагающих эти породы. Если под действием внешних сил структурное сцепление между минеральными частицами не будет разрушено, то грунты будут деформироваться как сплошные тела, минеральные частицы будут только сближаться, уплотняться без взаимного перемещения, что обусловит изменение объема грунта, поэтому эти деформации называют объемными. Если же структурное сцепление будет разрушено, то деформации в грунтах будут определяться перемещением отдельных минеральных частиц или агрегатов. Такие деформации называют сдвигом. Отсюда механические свойства рыхлых горных пород при воздействии на них внешних воздействий характеризуются показателями сопротивления их сжатию и сдвигу, которые являются основными количественными показателями при оценке сжимаемости, прочности к устойчивости пород в основании сооружений, в откосах выемок и других сооружениях.

Сопротивление грунтов к сжатию.

Сжимаемость - способность грунтов уменьшаться в объеме.

При одноосном сжатии скальных грунтов возникают как упругие деформации, которые восстанавливаются после окончания сжатия, так и остаточные деформации из-за наличия в грунтах не очень плотного примыкания частиц друг к другу и микротрещин.

Сжатие песков происходит быстро и мало связано с их влажностью. В отличии от песков сжимаемость глинистых пород зависит от их влажности, минералогического состава, характера структурных связей между частицами грунта и др. факторов. Неравномерная сжимаемость глинистых пород может быть причиной их неравномерной осадки и деформации.

Сжимаемость мягкого связного или рыхлого несвязного грунта можно охарактеризовать зависимостью коэффициента пористости от давления при сжатии образца в компрессионных приборах - компрессионной кривой и двумя показателями: коэффициентом уплотнения (а) и модулем осадки (/). Компрессионные кривые носят характер логарифмической зависимости коэффициента пористости Е от нагрузки Р. С увеличением давления грунт сжимается и коэффициент пористости уменьшается (ветвь нагрузки).  При снятии нагрузки некоторые грунты частично (при упругой деформации) восстанавливают свою пористость. Поэтому кривая разгрузки, располагаясь ниже кривой нагрузки, поднимается по оси ординат при нагрузках от максимальной до нулевой. В качестве рассчитанных показателей при проектировании сооружений используется коэффициент уплотнения (а) и модуль осадки ().

Коэффициент уплотнения представляет собой отношение уменьшения коэффициента пористости к величине повышения давления а =. Он определяется на компрессионной кривой для определенного интервала давлений (в см 2/кгс).

а = .

Модулем сжатия называется величина, обратная коэффициенту уплотнения.

E = .

Модулем осадки  показывает величину сжатия грунта (мм) приходящуюся на 1м толщи грунта при определенной нагрузке Р (кгс/см2).

Если  = 25 мм/м, то это значит, что метровый слой грунта при давлении Р = 2 кгс/см сжимается на 25 мм.

Зная мощность грунта в активной зоне h можно определить сжатие всего слоя в см .

h =

Задача

Определить модуль сжатия грунта Е, если нагрузка изменилась в пределах от Р1 = 2 кгс/см2 до Р2 = 6 кгс/см2. Результаты компрессионных испытаний см (рис. 1)

Решение:

а =  (значит грунт среднесжимаем).

Е =

При значительных нагрузках (20 – 30 кгс/см2) частицы могут раскалываться, в результате чего образуется более мелкозернистый грунт.

Сопротивление грунтов сдвигу.

Сопротивление грунтов сдвигающим нагрузкам зависит в общем случае от сцепления и трения. Сцепление проявляется в основном в грунтах связных. В скальных грунтах сцепление наибольшее и обусловлено химическими связями. В мягких связных грунтах (глина, суглинок, лесс, супесь) связность обусловлена цементирующим, склеивающим действием коллоидов и молекулярным сцеплением при непосредственном контакте частиц. Сопротивление сдвигу в этих грунтах оказывают в начале силы сцепления, а затем при сдвигающих нагрузках, их превышающих, силы трения между частицами. В рыхлых несвязных грунтах сопротивление сдвигающим усилиям оказывают только силы трения.

Для рыхлых грунтов на графике получается прямая, проходящая через начало координат. T = P*f=Ptg

Т - сопротивление сдвигу, кгс/см2;

Р - нормальная нагрузка, кгс/см2;

f - коэффициент внутреннего трения;

- угол внутреннего трения.

Для связных грунтов сопротивление их сдвигу выражается следующей зависимостью:

T = P*f+C

С - сцепление грунта, а остальные аналогичны таковым в предыдущей формуле.

1.                   Назовите характеристики грунтов.

2.                   В чем заключается разница в структуре грунта и текстуре?

"Индивидуальное и историческое развитие" - тут тоже много полезного для Вас.

3.                   Что понимают под структурными связями?

4.                   Дать инженерно-геологическую классификацию грунтов.

5.                   Что понимают под сжимаемостью грунта?

6.                   Что понимают под модулем сжатия грунта?

7.                   От чего зависит сопротивление грунтов сжимающим нагрузкам?

Не удается найти страницу | Autodesk Knowledge Network

(* {{l10n_strings.REQUIRED_FIELD}})

{{l10n_strings.CREATE_NEW_COLLECTION}}*

{{l10n_strings.ADD_COLLECTION_DESCRIPTION}}

{{l10n_strings.COLLECTION_DESCRIPTION}} {{addToCollection.description.length}}/500 {{l10n_strings.TAGS}} {{$item}} {{l10n_strings.PRODUCTS}} {{l10n_strings.DRAG_TEXT}}  

{{l10n_strings.DRAG_TEXT_HELP}}

{{l10n_strings.LANGUAGE}} {{$select.selected.display}}

{{article.content_lang.display}}

{{l10n_strings.AUTHOR}}  

{{l10n_strings.AUTHOR_TOOLTIP_TEXT}}

{{$select.selected.display}} {{l10n_strings.CREATE_AND_ADD_TO_COLLECTION_MODAL_BUTTON}} {{l10n_strings.CREATE_A_COLLECTION_ERROR}}

Свойства грунтов

Рассмотрим группу характеристик грунта, которые используют при расчетах несущей способности основания или откоса, давления на крепь горных выработок или подпорную стенку и т. д. Свойства грунтов объединены в группы: физические, водно-физические и характеристики мерзлых грунтов.

Физические свойства

Эта группа включает характеристики, отражающие влажность, плотность, удельный вес, пористость (рис. 1), тепловые, электрические, магнитные и другие свойства.


Рис. 1. Графическое изображение физических характеристик грунта:
а — влажности; б — плотности; в — удельного веса; г — пустотности. 1, 2, 3 — соответственно газовый, жидкий и твердый компоненты грунта; 4 — вес грунта, сниженный за счет взвешивающего действия воды

К характеристикам влажности относят природную и гигроскопическую влажности, максимальную молекулярную влагоемкость и степень влажности (см. рис. 1, а). Первые три характеристики ω, ωg и ωmmc — это отношение массы воды в грунте естественного состояния, воздушно-сухом и содержащем только рыхлосвязанную пленочную воду, к массе сухого грунта. Степень влажности Sr — это отношение природной влажности к влажности полного водонасыщения. Все четыре характеристики выражаются в долях единицы. Степень влажности определяется расчетным путем, а три другие характеристики — экспериментально по ГОСТ 5180–84 «Грунты. Методы лабораторного определения физических характеристик». Сохранять ненарушенную структуру образца при этом не требуется. Степень влажности является классификационной характеристикой, с ее помощью грунты разделяют на маловлажные (0–0,5), влажные (0,5–0,8) и водонасыщенные (0,8–1). Три другие характеристики используются в расчетах других показателей (табл. 1).

К характеристикам, отражающим концентрацию массы вещества в грунте, относятся четыре разновидности плотности: плотность грунта ρ, плотность сухого грунта ρd, плотность частиц грунта ρs и плотность грунта при влажности полного водонасыщения ρsat. Во всех случаях это отношение массы к объему (см. рис. 1, б). Плотность грунта и частиц грунта определяют прямыми экспериментальными методами по ГОСТ 5180–84, а плотности сухого и полностью водонасыщенного грунта — расчетом (см. табл. 1). При определении плотности грунта ρ требуется сохранять природную влажность и ненарушенную структуру. Все четыре характеристики не являются классификационными и используются в расчетах других показателей. Измеряют их в килограммах на кубический метр.

Таблица 1. Формулы для расчета физических характеристик грунта
Примечание. ρω — плотность воды, ρω = 1000 кг/м3.


К характеристикам, отражающим концентрацию веса грунта, относятся удельный вес грунта γ, удельный вес сухого грунта γd, удельный вес частиц грунта γs, удельный вес с учетом взвешивающего действия воды γsb и удельный вес полностью водонасыщенного грунта γsat (см. рис. 1, в). Определяют эти показатели расчетом, путем умножения соответствующей плотности на ускорение свободного падения. Удельный вес грунта используется для расчета давления от собственного веса грунта и других, связанных с ним давлений, а также характеристик и процессов, где нужно знать вес грунта или его частей. Удельный вес измеряют в килоньютонах на кубический метр.

К характеристикам, отражающим содержание пустот в грунте, относятся коэффициент трещинной пустотности, пористость и коэффициент пористости. Коэффициент трещинной пустотности kтр относится к трещиноватым грунтам, представляет собой отношение площади (объема) трещин к общей площади обнажения (объему блока) и измеряется в долях единицы. Этот показатель чаще всего определяют прямыми обмерами трещин в полевых условиях на обнажениях и на кернах или фотоспособом в скважинах. Он служит классификационной величиной и используется для отнесения массива грунта к одной из категорий по трещиноватости. Пористость n и коэффициент пористости e используют для оценки пустот в грунте с равномерным их распределением. Пористость — это отношение объема пор к общему объему грунта, а коэффициент пористости — отношение того же объема пор к объему твердой части грунта. Таким образом, пористость n представляет собой долю объема грунта, приходящуюся на пустоты, а коэффициент пористости e — соотношение объемов пор и твердой части грунта. Обе характеристики выражаются в долях единицы и связаны между собой (см. табл. 1 и рис. 1, г).

Определяют их чаще всего расчетом с использованием других характеристик. Пористость применяют в расчетах других показателей, а коэффициент пористости также служит классификационной величиной для оценки плотности сложения песка и выделения ила из глинистого грунта.

Другие физические характеристики используются в горном деле редко и здесь не приводятся.

Свойства почвы - Science Learning Hub

Все почвы содержат минеральные частицы, органические вещества, воду и воздух. Их комбинации определяют свойства почвы - ее текстуру, структуру, пористость, химический состав и цвет.

Текстура почвы

Почва состоит из частиц разного размера. Текстура почвы относится к размеру частиц, из которых состоит почва, и зависит от доли песка, ила, частиц размером с глину и органических веществ в почве.Песчаные почвы кажутся песчаными, если их растереть между пальцами. Ил на ощупь гладкий - немного похож на муку. Большинство глин липкие и пластичные. Если вы когда-нибудь использовали гончарную глину, вы знаете это чувство.

Почвы состоят из различных комбинаций частиц песка, ила и глины. Почвы, представляющие собой смесь песка, ила и глины, называются суглинками. Название почвы часто определяет доминирующую частицу, например, илистый суглинок Тимару описывает почву, в которой преобладает ил. Другими примерами новозеландских почв являются глина Вайкаре и песок Те Копуру.

Текстура почвы может влиять на то, являются ли почвы свободным дренажем, удерживают ли они воду и насколько легко корни растений прорастают.

  • Частицы песка довольно большие. Пористые пространства между частицами в песчаных грунтах также довольно большие. Это позволяет воде быстро стекать, а воздуху попадать в почву. Песчаные почвы зимой не заболачиваются, но летом могут быть засухи.
  • Частицы ила слишком малы, чтобы их можно было увидеть глазами. Иловые почвы имеют гораздо меньшие поры, но их намного больше.
  • Частицы глины меньше 0,002 мм в диаметре. Глинистые почвы плохо дренированы и намного дольше задерживают воду в своих поровых пространствах. Однако они могут стать очень твердыми, если высохнут.

Структура почвы

Структура почвы описывает способ скопления частиц песка, ила и глины. Органические вещества (разлагающиеся растения и животные) и почвенные организмы, такие как дождевые черви и бактерии, влияют на структуру почвы. Глины, органические вещества и материалы, выделяемые почвенными организмами, связывают частицы почвы вместе, образуя агрегаты.Структура почвы важна для роста растений, регулирует движение воздуха и воды, влияет на развитие корней и влияет на доступность питательных веществ. Почвы хорошего качества рыхлые (рыхлые) и имеют мелкие заполнители, поэтому почва легко разрушается, если вы ее сдавливаете. Плохая структура почвы имеет крупные, очень плотные комья или вообще ее отсутствие.

Пористость почвы

Пористость почвы относится к порам в почве. Пористость влияет на движение воздуха и воды. Здоровые почвы имеют множество пор между агрегатами и внутри них.На почвах низкого качества мало видимых пор, трещин или ям. Способ обработки почвы может повлиять на ее пористость. Например, посмотрите на районы вокруг вашей школы, по которым ученики регулярно ходят пешком. Если трава стерта, а почва обнажена, она часто выглядит иначе, потому что она уплотнена, а ее структура и пористость изменились. Это также области, где образуются лужи, потому что вода не может стекать.

Химия почвы

Глины и органические вещества в почве несут отрицательный заряд.Вода в почве растворяет питательные вещества и другие химические вещества. Такие питательные вещества, как калий и аммоний, имеют положительный заряд. Их привлекают отрицательно заряженные органические и минеральные вещества, и это предотвращает их потерю в результате выщелачивания при движении воды через почву. Нитрат имеет отрицательный заряд, поэтому в большинстве почв он не защищен от выщелачивания.

Почвы могут быть кислыми, щелочными или нейтральными. PH почвы влияет на усвоение питательных веществ и рост растений. Некоторые растения, такие как кумара и картофель, лучше всего растут в более кислой почве (pH 5.0–6,0). Морковь и салат предпочитают почвы с нейтральным pH 7,0. Со временем почва может стать более кислой из-за вымывания минералов. Известь часто добавляют в почву, чтобы сделать ее менее кислой. Загоны Новой Зеландии регулярно покрываются известью для улучшения роста пастбищ.

Цвет почвы

Если вы думали, что все почвы коричневые, подумайте еще раз. Цвета почвы варьируются от черного до красного и белого. Иногда даже может быть синим! Цвет почвы в основном зависит от органических веществ и железа. Верхний слой почвы часто бывает темным из-за органических веществ.Ровный однотонный цвет означает, что почва хорошо дренирована. Напротив, ржавые пятна и серые пятна (иногда даже голубого цвета) указывают на плохой дренаж.

Сопутствующее мероприятие

В этом упражнении учащиеся проводят визуальную оценку почвы, чтобы изучить структуру почвы и найти дождевых червей.

Природа науки

Для научного общения нам необходимо использовать правильные термины, словарный запас и условные обозначения. Одна из конвенций предполагает использование древнегреческих или латинских слов для разработки новых терминов.Например, почвоведение - это научное изучение почв. Название происходит от двух греческих слов - «педон», что означает почва, и «логос», что означает изучение.

Полезные ссылки

Текстура почвы влияет на то, как вода движется через почву. Послушайте, как почвовед Сэм Каррик обсуждает новый способ изучения движения воды и мочи животных в каменистых почвах Кентербери в этом интервью RNZ.

Характеристики городских почв и ограничения для озеленения в Гонконге

Автор ссылается на открытую накладную панельC.YJimShow подробнее

Аннотация

Почвам в городских районах не уделялось должного внимания в связи с озеленением ландшафта. Недавние исследования городских деревьев в Гонконге выявили множество проблем, связанных с садоводством, связанных со стрессовыми условиями среды обитания, включая почвенные. Почвенные ограничения в густонаселенном городе являются острыми, но соответствующие данные отсутствуют. В рамках этого проекта была проведена полевая и лабораторная оценка 100 образцов почвы, взятых из участков с различной природной историей и историей нарушений на сложных придорожных участках с ямами для деревьев в городском Гонконге.Был оценен широкий спектр физических и химических свойств, чтобы установить исходную информацию об ограничениях почвы для роста благоустроенной растительности. Большинство почв утратили естественные почвенные горизонты с морфологическими особенностями насыпного материала, такими как плохая структура и искусственное наслоение. Они чрезмерно каменистые, крупнозернистые, с обилием строительного мусора и других посторонних веществ. Обширное уплотнение почвы, связанное со структурной деградацией и потерей пористости, препятствует аэрации, дренажу, хранению доступной для растений влаги и росту корней.Выбросы карбоната из известковых строительных отходов вызывают щелочной pH, что сказывается на дефиците питательных микроэлементов и фосфора. Содержание органических веществ и связанные с ними поставки необходимого азота и фосфора очень скудны. Способность удерживать питательные основы и количество, содержащееся в доступных формах, недостаточны для энергичной продуктивности растений. Есть признаки загрязнения тяжелыми металлами, особенно свинцом, которые поступают из переносимых по воздуху источников, связанных с автомобильным движением.Результаты помогают установить необходимость проведения испытаний почвы при озеленении, укрепить слабое звено в программах ландшафтного дизайна, разработать пакет рекомендаций по улучшению управления почвенными ресурсами в городах, повысить рентабельность программ озеленения и улучшить городское благоустройство. производительность дерева, чтобы уменьшить текущую ответственность и нагрузку на руководство.

Ключевые слова

Городская почва

Городское дерево

Городская экология

Ограничение почв

Уплотнение почвы

Управление почвой

Гонконг

Рекомендуемые статьи Цитирующие статьи (0)

Все права защищены. © Else000v2, 1998 год. .V. Все права защищены.

Рекомендуемые статьи

Ссылки на статьи

Объяснение характеристик почвы »Портал почв Новой Зеландии

Почвы обладают множеством свойств, которые мы можем измерить, чтобы изучить их состояние или «здоровье». Вы можете сравнить почву с вашим телом, а почвоведа с врачом, который пытается получить информацию о вашем здоровье, когда они измеряют ваше кровяное давление или другие характеристики вашего тела.

Для описания характеристик почвы обычно используются три категории: химические, физические и биологические свойства.

Химические свойства почвы

Химические свойства широко описывают плодородие почвы, количество и доступность питательных веществ для роста растений. Химические свойства также включают загрязняющие вещества и токсичные элементы.

Это наиболее часто измеряемые химические свойства, и почему они важны:

  • pH
    pH - это показатель кислотности почвы. Это очень важная характеристика почвы, так как pH влияет на многие химические реакции и биологические процессы.Каждая химическая реакция и каждый почвенный организм имеют свой любимый pH, при котором они работают лучше всего, а также верхний и нижний предел, при котором реакции больше не работают или организм умирает. Следовательно, pH может многое рассказать нам о происходящих химических реакциях и об организмах, которые могут жить в почве. PH почвы обычно измеряется в смеси воды и почвы с помощью pH-метра, который измеряет активность ионов водорода (H + ), поскольку эти ионы создают кислотность.
    ФАО подготовила инфографику, чтобы проиллюстрировать, как pH влияет на доступность питательных веществ в почве и на здоровье животных и растений, которые в ней живут.
  • Содержание органического вещества
    Органическое вещество - это отмершие растения и (микро) организмы, которые разлагаются в почве. Темный цвет верхнего слоя почвы, компоста и почвенной смеси является следствием этого органического вещества. Разложение мертвого материала - это способ вторичного использования питательных веществ: дождевые черви, грибки, бактерии и многие другие почвенные организмы поедают органические вещества, и в результате их переваривания питательные вещества снова попадают в почву. Таким образом, органическое вещество является мерой плодородия почвы.Содержание органического вещества в почве обычно измеряется как общий углерод, потому что органическое вещество состоит в основном из углерода и обычно является единственным источником углерода в почвах Новой Зеландии.
  • Удержание фосфата
    Фосфат - это химическая форма фосфора, которую могут усваивать растения. Удержание фосфата - это количество фосфата, которое почва может адсорбировать на частицах. Если фосфат сильно адсорбируется, он недоступен для растений, но если он не адсорбируется, существует риск вымывания фосфата в грунтовые воды, где он считается загрязняющим веществом.Удержание фосфата измеряется путем добавления известного количества фосфата в образец почвы и анализа того, сколько фосфата все еще находится в растворе и, следовательно, не адсорбируется в почве.
  • Катионообменная емкость (CEC)
    Важные питательные вещества для растений кальций, магний и калий имеют положительный химический заряд и называются катионами. Катионы образуют химически простые связи с отрицательно заряженными частицами глины и органическими веществами. Растения могут получить доступ к этим катионам питательных веществ.Количество отрицательно заряженных пространств, доступных для связывания катионов, называется катионообменной емкостью почвы. Если для катионов питательных веществ доступно много места, это признак хорошего плодородия почвы. Емкость катионного обмена измеряется, сначала удаляя все катионы с отрицательно заряженных участков образца почвы, а затем добавляя «передозировку» катионов к образцу, так что все участки обмена будут заполнены. Наконец, образец почвы снова промывают, чтобы все катионы покинули центры обмена, и мы можем измерить, сколько катионов было связано с отрицательно заряженными центрами обмена, и это дает нам количество доступных мест обмена.

Физические свойства почвы

Движение и накопление воды и воздуха в почве - это физические свойства, а также то, насколько легко копать или обрабатывать почву.

Это наиболее часто измеряемые физические свойства, и почему они важны:

  • Текстура
    Текстура относится к размеру отдельных частиц в почве, за исключением гравия и камней. Текстура традиционно измеряется путем смешивания образца почвы с водой, после удаления гравия и камней просеиванием и измерения времени, необходимого для осаждения частиц разного размера.Частицы песка являются самыми крупными и поэтому сначала оседают в воде, а затем в иле и глине.
    Песок: частицы диаметром от 0,06 до 2 мм; Ил: частицы диаметром от 0,002 до 0,06 мм; Глина: частицы диаметром менее 0,002 мм.
    Классы текстуры - это преобладающий размер частиц смеси почвы в вашем образце:
    Песок: менее 8% глины и менее 40% ила; Ил: менее 40% ила;
    Суглинок: более 40% ила; Глина: более 35% глины.
  • Структура
    Структура почвы описывает, как частицы почвы собираются вместе в агрегаты.Если отдельные частицы почвы совсем не связаны, структура почвы (отдельные зерна) отсутствует. Структура почвы скрепляет почву и создает воздушные карманы для дыхания корней растений и организмов. Структура измеряется путем взятия пальцами образца почвы и определения того, насколько легко он ломается. В качестве альтернативы, в лаборатории структуру почвы можно измерить более точно, применив силу и измерив, сколько силы необходимо для разрушения агрегатов почвы.
  • Цвет
    Цвет почвы говорит нам о том, сколько органических веществ может присутствовать в почве из-за ее темноты.Цвет почвы также может сказать нам, какие процессы происходят в почве, например, из-за застоя воды почва становится сероватой с оранжевыми пятнами, а перемещение органических веществ или железа окрашивает почву на разную глубину. Цвет различных горизонтов почвы описывается специальной таблицей цветов, называемой шкалой Манселла, путем сравнения цвета влажной почвы с цветами в книге Манселла.
  • Насыпная плотность
    Насыпная плотность - это масса сухого грунта в определенном объеме.В почвах без большого количества камней мы измеряем объемную плотность, заполняя контейнер, обычно стальной цилиндр, почвой, проталкивая его в почву. Затем мы сушим почву и взвешиваем ее, чтобы определить массу, и мы знаем объем цилиндра, чтобы мы могли рассчитать насыпную плотность. В почвах с большим количеством камней слишком сложно вдавить цилиндр в почву, поэтому вместо этого мы выкапываем небольшую ямку, отвозим всю почву в лабораторию, сушим и взвешиваем, чтобы получить массу, и мы заполняем яму. полиэтиленовым пакетом и наполните его пластиковыми бусинами, и по количеству бусинок, заполняющих отверстие, мы можем рассчитать его объем.Почвы с низкой насыпной плотностью являются рыхлыми и легко проходят корни и воду, почвы с высокой насыпной плотностью тяжелые, и их часто трудно копать или вспахивать.
  • Водоудерживающая способность
    Этот параметр описывает, сколько воды может удерживать почва, как губка, и это важно для растений, поскольку определяет, сколько воды хранится в почве. Влагоудерживающая способность измеряется путем насыщения образца почвы в контейнере водой, а затем слива избыточной воды и измерения количества воды, остающейся в почве.Водоудерживающая способность во многом зависит от текстуры почвы, рыхлые песчинки не удерживают много воды, а плотная глинистая почва впитывает много воды.
  • Гидравлическая проводимость
    Степень протекания воды через почву измеряется с помощью гидравлической проводимости. Это можно измерить, измерив, сколько воды проходит через образец почвы при приложении определенного давления. Гидравлическая проводимость почвы зависит от размера пор, который зависит от структуры и текстуры почвы.Более крупные частицы почвы создают более крупные поры между частицами и облегчают прохождение воды через почву. Когда частицы почвы, даже когда они маленькие, собираются в агрегаты, они также образуют большие поры, и это также заставляет воду двигаться быстро.

Биологические характеристики почвы

Биологические свойства описывают (микро) организмы, живущие в почве, кто они и сколько их, или насколько они активны и чем занимаются.

Это наиболее часто измеряемые биологические свойства, и почему они важны:

  • Дождевые черви
    Дождевые черви часто используются в качестве положительного индикатора биологического качества почвы: дождевые черви разлагают органические вещества, делая питательные вещества доступными для растений, и их каналы позволяют воздуху и воде попадать в почву. Дождевые черви не любят почву, по которой они не могут перемещаться, и это обычно означает, что другие, более мелкие организмы также не любят эту почву, поэтому дождевые черви являются индикатором, показывающим нам, является ли почва хорошим местом для жизни. для многих почвенных организмов.
  • Минерализующийся азот
    Азот присутствует в почве в виде органического азота и не может усваиваться растениями. Микроорганизмы могут расщеплять органический азот и делать его доступным для растений, и этот процесс называется азотной минерализацией. Мы можем измерить, сколько азота в почве потенциально может быть минерализовано и доступно для растений, так что это своего рода запас азота в банке для растений.
  • Микробная биомасса
    Почва живая и полна микроорганизмов, которые мы не видим невооруженным глазом.Чтобы измерить количество присутствующих микроорганизмов, их биомассу, мы сначала анализируем, сколько углерода мы можем извлечь из почвы, пока микроорганизмы активны. Затем мы инактивируем микроорганизмы, добавляя хлороформ к образцу, и мы снова измеряем количество извлекаемого углерода, увеличение углерода происходит от микроорганизмов, и, вычисляя разницу, мы знаем биомассу микроорганизмов, присутствующих в нашем образце.
    Это прямое измерение микробной биомассы, но мы также можем оценить количество микроорганизмов по их дыханию (см. «Базальное дыхание») или с помощью методов ДНК (см. «Состав микробного сообщества»).
  • Базальное дыхание
    Все микроорганизмы в почве и корнях растений дышат так же, как и мы.Представьте себе, что вы измеряете собственное дыхание, когда вы дышите нормально, по сравнению с тем, когда вы занимаетесь спортом или бегаете. Мы также можем сделать это для почвенных микроорганизмов. Базальное дыхание - это нормальное дыхание микроорганизмов, и мы можем просто взять образец почвы и измерить количество CO 2 , которое выходит из образца с течением времени, обычно в течение дня или около того. Затем мы узнаем, сколько микроорганизмов дышит, и мы также можем оценить их количество по их дыханию. Если мы хотим, мы можем сравнить это нормальное дыхание между разными почвами или заставить организмы работать усерднее, дав им дополнительную пищу или воду, и посмотреть, как они изменяют свое дыхание.Это говорит нам об активности микроорганизмов в почве.
  • Состав микробного сообщества
    Анализ ДНК позволяет идентифицировать микроорганизмы в почве, которые не видны невооруженным глазом. Таким образом, мы можем идентифицировать все бактерии, грибки и другие микроорганизмы, обитающие в конкретной почве, и это называется составом сообщества, как если бы вы записали все имена людей и животных, которые живут в вашем районе. Если вы также напишете все рабочие места и навыки, которыми обладают жители вашего района, вы получите представление о том, чего может достичь ваш район.То же самое можно сделать и с микробными сообществами в почве, некоторые виды играют очень специфические роли в почве, и их присутствие в почве может сказать нам, что происходит с рециркуляцией питательных веществ, удалением загрязнителей или атаками патогенов на растения. Мы также можем приблизительно оценить количество микроорганизмов в почве, измерив, сколько ДНК мы находим в почве, хотя это не очень точно.

Хотите узнать больше?

Загляните в наши лаборатории почв и узнайте об имеющихся у нас средствах определения характеристик почвы.

Не стесняйтесь изучать наш глоссарий S-map для характеристик почвы и терминов, которые не упомянуты выше:
https://smap.landcareresearch.co.nz/help/glossary/

Влияние характеристик почвы | Энциклопедия канолы

Все почвы содержат растворимые соли. Когда уровень достаточен, чтобы нанести вред растениям, почвы называют засоленными. Культуры будут различаться по устойчивости к засолению. Канола считается умеренно толерантной к соли и натрию и может переносить соленость до уровней от пяти до шести децисименс на метр (дСм / м).

Засоленные почвы очень плодородны и часто содержат большое количество органических веществ. Это может быть вызвано снижением урожайности сельскохозяйственных культур в этих районах, где питательные вещества накопились за годы сплошного внесения питательных веществ. Зональное картирование поля на основе электропроводности (например, использование Veris или EM38) для разработки предписания переменной нормы может улучшить эту ситуацию за счет автоматического отключения внесения удобрений при прохождении над засоленными участками. Это приведет к снижению накопления питательных веществ, повышению эффективности использования удобрений и уменьшению выбросов парниковых газов.

Соленость - это не только проблема соли. Засоление является результатом того, что избыток грунтовых вод движется вниз и в поперечном направлении через почву, растворяя и транспортируя растворимые соли . На обширных территориях канадских прерий есть почва с относительно высоким содержанием растворимых солей. Перераспределение этих растворимых солей за счет движения грунтовых вод приводит к тому, что некоторые районы становятся чрезмерно засоленными. Когда дренаж эффективен, соли вымываются через почву из корневой зоны. Когда дренаж безуспешен (напр.на низких, равнинных участках или участках с впадинами, или на участках, где дороги или другие сооружения препятствуют нормальному дренажу) уровень грунтовых вод повышается. Когда уровень грунтовых вод поднимается до уровня в пределах одного метра (трех футов) от поверхности, вода и соли могут подниматься на поверхность за счет капиллярного действия. Вода испаряется, а соли накапливаются на поверхности.

Засоление также встречается в солевых выходах на склонах холмов, часто частично вверх по склону на очень длинных и высоких холмах. Дождь на склоне холма (зона подпитки) движется вниз через почву, собирая по пути соли.Вода, не используемая растениями, спускается вниз, пока не достигнет непроницаемого слоя, который препятствует ее продвижению. Затем вода течет вбок (просачивается), пока не достигнет положения ниже по склону, где уровень грунтовых вод находится ближе к поверхности. Там просачивающаяся вода заставляет уровень грунтовых вод подниматься, позволяя соленой воде подниматься на поверхность почвы за счет капиллярного действия. Явление просачивания может происходить на относительно небольших расстояниях в пределах одного поля или на расстояниях в несколько миль. Уровни солености широко варьируются в пределах солевого выхода.Соленость также меняется от весны к осени. Засоление обычно появляется на поверхности почвы сразу после весеннего таяния .

Доминирующими солями в просачиваемых соляных растворах прерий являются катионы кальция (Ca), магния (Mg) и натрия (Na) и анионы сульфата (SO 4 ). Если уровень натрия высок или не сбалансирован с кальцием и магнием, это также может повлиять на обработку почвы. Положительно заряженные катионы натрия прикрепляются к отрицательно заряженным частицам глины в почве, в результате чего почва становится липкой во влажном состоянии и твердой и непроницаемой в сухом.

Засоленные почвы можно распознать по пятнистому нарастанию сельскохозяйственных культур или по белым солевым коркам, которые накапливаются на поверхности почвы, обычно в низинных районах. В почве могут присутствовать полосы соли, даже если на поверхности может не появиться белая корка. Во многих засоленных почвах невозможно увидеть соли, и необходимо провести лабораторный анализ почвы, чтобы подтвердить их присутствие.

Растения, растущие в засоленных районах, могут приобретать сине-зеленый оттенок. Солеустойчивые сорняки, такие как чертополох, кочия, дикий ячмень и гусиный ячмень, обычно встречаются в районах с высокой концентрацией соли .

Процесс накопления солей уменьшается, когда растения перехватывают восходящий поток соленых грунтовых вод и уменьшают количество, достигающее поверхности почвы. Когда растений нет, почти вся потеря воды происходит за счет испарения с поверхности почвы. Summerfallow является основным фактором солености, поскольку способствует увеличению уровня грунтовых вод. Вода, не используемая растениями, накапливается в подпочве и в конечном итоге выходит на поверхность с солями. Эти соли препятствуют прорастанию семян и укоренению растений.

Вся оросительная вода содержит немного соли. В течение длительного периода орошения, когда дренаж почвы недостаточен, в почве накапливаются соли, и может возникнуть проблема засоления. Вода, используемая в основных ирригационных районах Альберты и Саскачевана, высокого качества с небольшим риском накопления солей. Засоление или высокий уровень грунтовых вод в результате чрезмерного орошения вызывают наибольшее засоление при орошении.

Влияние засоления на рост и урожай канолы

Влияние засоления почвы на урожайность при сборе урожая

Некоторые виды растений переносят высокие уровни засоления, в то время как другие - низкие или совсем не засоленные.Следовательно, солеустойчивость относится к относительному росту растений при засолении. Солеустойчивые растения избегают токсичности за счет связывания ионов натрия (Na +) и хлорида (Cl-) либо в вакуолях, либо в корнях по механизму исключения соли . Солевой толерантность обычно дается с точки зрения стадии роста растений в диапазоне уровней электропроводности. Степень засоления или общая концентрация растворимых солей в почве обычно измеряется лабораториями по исследованию почвы с помощью теста на проводимость.Электропроводность (ЕС) - это способность раствора передавать электрический ток. Единицы электропроводности обычно выражаются в децисименсах на метр (дСм / м). В следующей таблице соленость классифицируется по общим диапазонам от незасоленного до очень сильно засоленного. Эти значения используются для выбора растений на засоленных почвах.

Таблица 2. Рейтинг солености и значение электропроводности

Таблица 2. Рейтинг солености и значение электропроводности

дСм / м = децисименс на метр

Влияние засоления почвы на всхожесть канолы

Избыток растворимых солей вызывает осмотический стресс и ионную токсичность в растительных клетках.Для нормального роста растениям нужна как вода, так и растворенные в ней питательные вещества. Сок в корнях растений содержит соль, которая притягивает воду в растение за счет осмотического давления. Растворенные в почве соли повышают осмотическое давление почвенного раствора. Это снижает скорость попадания воды из почвы в корни. Если почвенный раствор станет слишком концентрированным, растения будут медленно обезвоживаться, терять тургор и голодать, даже если запас воды и питательных веществ в почве может быть довольно высоким.Если содержание солей в почвенной воде становится слишком насыщенным, вода может фактически отказываться от корней. Осмотический стресс также является результатом высыхания и, следовательно, является частым компонентом как засухи, так и солевого стресса. Высокая концентрация определенных солей в почве также может быть токсичной, потому что некоторые растения могут поглощать избыточное количество соли, замедляя рост или вызывая смерть.

Канола считается умеренно толерантной к соли и натрию и может переносить умеренную соленость до уровней от пяти до шести децисименс на метр.Канола более чувствительна к засолению во время прорастания и всходов, чем на более поздних стадиях роста .

Согласно исследованию засоленности, проведенному Министерством сельского хозяйства и агропродовольствия Канады Сельское хозяйство и агропродовольствие Канады является отделом правительства Канады. в Свифт-Каррент, Саскачеван, повышение уровня засоления почвы привело к снижению всхожести, всхожести и всхожести . Это тепличное исследование показало, что процент всхожести и выживаемость растений существенно не изменился, пока засоление не превысило 5.6 децисименс на метр. Выше этого значения увеличивается количество дней от посева до появления всходов. При сильном засолении растения прорастали быстро, но со временем процент выживших уменьшался.

Засоление как в умеренных, так и в тяжелых условиях снижает среднюю высоту растений, биомассу побегов и корней, количество листьев, площадь листьев, эвапотранспирацию и урожайность при сборе урожая. Например, средняя высота урожая в исследовании, показанном на этом графике, составляла в среднем 167, 132 и 84 см (66, 52 и 33 дюйма) соответственно для 0.6, 5,6 и 12,4 децисименс на метр обработки. Рост корней также затруднен при солености выше шести децисименс на метр. При уровне 5,6 децисименс на метр урожай канолы в этом исследовании был снижен на 60 процентов, а при сильном засолении урожайность канолы снизилась на 80 процентов. Однако несколько других исследований показали, что при уровне солености до 10 децисименс на метр влияние на урожай канолы было незначительным.

Влияние степени адсорбции натрия на урожай канолы

Испытания почвы покажут масштабы проблемы засоления.При отборе проб собирайте изображения как для затронутых, так и для незатронутых участков поля. Выполните анализ электропроводности, pH, катиона Положительно заряженный ион (ион с чистым положительным зарядом). щелочная насыщенность и содержание кальция, магния, натрия и органических веществ.

Когда уровни натрия в почве высоки по сравнению с кальцием и магнием, возникает другая проблема с почвой. Эти почвы очень липкие и скользкие во влажном состоянии и очень твердые, комковатые и склонные к образованию корки при высыхании.Адсорбция натрия - процесс электрического притяжения, которое удерживает катионы на отрицательных поверхностях почвенных коллоидов. Коэффициент (SAR) - это отношение натрия к полезным структурным катионам почвы, кальцию и магнию. Когда значение SAR превышает 13, почва называется натриевой. Если SAR превышает 13, а EC больше четырех, это считается засоленной натриевой почвой. Используйте тест почвы, чтобы определить SAR почвы.

Аргентинское исследование показало, что натрий, даже без образования корки на почве, может вызвать небольшое сокращение всхожести рапса при значениях SAR 20 и увеличение до 60% при значениях SAR выше 34.При значениях SAR выше 20 рост основного стебля и урожайность немного снизились, но увеличение количества второстепенных ветвей компенсировало это снижение. Уменьшение количества стеблей, семян на стручок на основном стебле, стручков на стебель и урожайность канолы, как правило, резко снижается, когда значения SAR превышают 34. Это может частично быть вызвано дефицитом кальция из-за чрезмерного количества натрия .

Влияние прочности корки на всхожесть канолы

Однако наиболее важным действием натрия в почве является усиление корки, которая снижает всхожесть.Количество натрия, необходимое для воздействия на всхожесть, намного выше, чем необходимо для диспергирования и образования корки глины. Аргентинское исследование показало, что значения SAR, равные восьми и даже ниже, могут способствовать диспергированию глины и образованию корки, когда капли дождя ударяют по поверхности почвы. Рапс имеет небольшой размер семян, и при прорастании семядоли проталкиваются через почву на поверхность, что затрудняет всходы в почвах с коркой. На образование корки также влияет гранулометрический состав почвы, поскольку высокая доля мелких частиц увеличивает восприимчивость почвы к образованию корки.Очень мелкие посевы в результате чрезмерной обработки почвы повышают склонность почвы к образованию корки. Прочность корки сильно влияет на всхожесть.

На почвах с умеренным засолением используйте сплошное земледелие или, по крайней мере, максимально удлините севооборот. Культуры используют воду, а не позволяют ей глубоко проникать в почву или накапливаться у поверхности почвы и способствовать перемещению соли.

На почвах с умеренным засолением используйте сплошное земледелие или, по крайней мере, максимально удлините севооборот.Культуры используют воду, а не позволяют ей глубоко проникать в почву или накапливаться у поверхности почвы и способствовать перемещению соли.

Используйте неглубокую обработку почвы и поддерживайте все возможные пожнивные остатки на поверхности почвы. Во многих случаях глубокая обработка почвы может просто вывести на поверхность больше солей и усугубить проблемы. Ранней весной семена канолы неглубокие, чтобы семена могли прорасти при временном снижении уровня соли на поверхности.

Если засоление почвы уже достигло стадии, при которой невозможно выращивать зерновые и масличные культуры, проконсультируйтесь с квалифицированными специалистами по почвам по процедурам борьбы с засолением и рекультивации засоленных земель.Засоление можно удалить механически, но для этого требуется орошение сверху и дренаж плитки под ним, чтобы вымыть соленость из почвы и слить ее.

границ | Характеристики почвенных грибных сообществ и производство мицелия через градиент нарушений в низинных тропических лесах диптерокарпия на Борнео

Введение

Тропические леса представляют собой наиболее биоразнообразные наземные экосистемы на планете (Myers et al., 2000) и обеспечивают глобально важный сток углерода (C) (Pan et al., 2011). Все более быстрое сокращение лесного покрова в результате землепользования и преобразования земель угрожает способности тропических лесов поддерживать биоразнообразие (Hansen et al., 2013; Powers and Jetz, 2019) и хранить C (Baccini et al., 2017). Значительная деградация лесов происходит в Юго-Восточной Азии, с самыми высокими темпами на Борнео (Bryan et al., 2013). С начала 1970-х годов расширение промышленных плантаций масличных пальм (OP) привело к потере> 30% лесного покрова (18,7 млн ​​га старовозрастных лесов), в то время как более 70% оставшихся лесов были затронуты селективным воздействием лесозаготовки для добычи коммерчески ценной древесины (Gaveau et al., 2014, 2016).

Функции экосистем и биогеохимические циклы (например, запасы углерода и динамика питательных веществ) поддерживаются сложными взаимодействиями между растениями и почвой, опосредованными взаимными обратными связями между надземной растительностью и микробными сообществами почвы (Wardle et al., 2004; van der Heijden et al., 2008). ; Bever et al., 2010; van der Putten et al., 2013; Cortois et al., 2016). Было показано, что изменения свойств почвы, связанные с нарушением лесов, оказывают значительное и долгосрочное воздействие на микробные сообщества и разнообразие во многих биомах (Hartmann et al., 2013; Mcguire et al., 2015). Однако, несмотря на важность взаимодействия микробов между растениями и почвой, понимание взаимоотношений между подземными сообществами и свойств почвы в тропических экосистемах остается ограниченным (Barberán et al., 2015; Mueller et al., 2016). Небольшое количество недавних исследований подчеркнуло чувствительность сообществ почвенных грибов к изменениям в землепользовании в Юго-Восточной Азии, включая влияние выборочных рубок и преобразования лесов в плантации масличных пальм на структуру и разнообразие сообществ (Kerfahi et al., 2014; Mcguire et al., 2015), хотя прямое влияние на функционирование грибных сообществ неясно.

Мицелий, продуцируемый активно питающимися почвенными грибами, является ключевым компонентом циклов углерода и минеральных питательных веществ в наземных экосистемах (Johnson et al., 2002; Finlay, 2008; Cairney, 2012). Внерадикальный мицелий микоризных грибов действует как прямые пути для взаимного обмена минеральными питательными веществами из почвы и фотосинтетическим углеродом между растениями и грибными симбионтами. Эта мутуалистическая ассоциация приносит пользу растению-хозяину за счет увеличения площади поверхности для поглощения минеральных питательных веществ из почвы в обмен на фотосинтаты растительного происхождения, необходимые для роста и выживания грибов (Smith and Read, 2008; Itoo and Reshi, 2013; Chen et al., 2016). Также известно, что микоризный симбиоз улучшает устойчивость растений к болезням и нарушениям окружающей среды, включая засуху и воздействие вредных загрязнителей (Smith and Read, 2008). Благодаря этому взаимовыгодному партнерству повышается продуктивность растений (Lambers et al., 2008; Nasto et al., 2014; Wurzburger and Clemmensen, 2018), что, в свою очередь, ведет к большему выделению углерода под землей растениями (Orwin et al., 2011) и Поставка углерода в более широкий микробиом почвы (Drigo et al., 2012; Nottingham et al., 2013). Недавние исследования подтвердили перенос питательных веществ между растениями одного или даже разных видов через общие мицелиальные сети (CMN), которые физически соединяют двух или более индивидуумов, что может поддерживать обмен между растениями на больших расстояниях (Bever et al., 2010; Barto et al. , 2012; Бабикова и др., 2013; Горзелак и др., 2015). Хотя этот процесс может влиять на выживание и рост растений, он также может способствовать посадке молодых деревьев, обеспечивая существующую инфраструктуру для доступа саженцев (Nara, 2006; Gorzelak et al., 2015). Хотя структуры гифов грибов сами по себе обеспечивают поглотитель углерода, они также могут вносить вклад в пулы органических веществ почвы за счет круговорота мицелия (Wallander et al., 2013) и защиты органических субстратов за счет воздействия на агрегацию почвы (Wilson et al., 2009; Rillig et al., др., 2015). Хотя точная роль производства и активности мицелия в динамике углерода в почве является спорной и остается областью активных исследований (Zak et al., 2019), недавние исследования выявили связи между структурой микоризного сообщества и хранением углерода в почве.Например, преобладание эктомикоризных (EcM) и арбускулярных микоризных (AM) грибов может потенциально влиять на накопление углерода в почве за счет конкуренции с сапротрофными грибами за ресурсы, необходимые для разложения органического вещества (Averill et al., 2014).

Производство мицелия регулируется рядом абиотических и биотических факторов, таких как доступность минеральных питательных веществ в почве (Hagerberg et al., 2003; Nilsson and Wallander, 2003; Potila et al., 2009; Ekblad et al., 2013), влажность почвы. (Majdi et al., 2008), климата (Bakker et al., 2015), фенологических / сезонных изменений в подземном распределении углерода (Ekblad et al., 2013) и прямого выпаса почвенной мезофауны, который может подавлять или стимулировать производство мицелия (Ek et al., 1994; Setäl et al., 1999). Сами структуры сообществ растений и грибов также имеют решающее значение для определения роста и круговорота мицелия (Clemmensen et al., 2015), поскольку изменения в растительности и сообществах грибов мицелия, связанные с управлением лесами, были связаны с моделями производства мицелия (Hagenbo et al., 2018). Однако количественная оценка скорости продукции мицелия в основном ограничивалась бореальными и умеренными биомами, в основном сосредоточиваясь на системах с преобладанием EcM в Скандинавии (Ekblad et al., 2013).

Низменные тропические леса Борнео характеризуются высокой численностью и преобладанием в пологе древесных видов, принадлежащих к облигатному EcM-ассоциирующему семейству Dipterocarpaceae (Whitmore, 1984; Taylor and Alexander, 2005; Brearley, 2012), при этом сообщества диптерокарповых сообществ потенциально опосредованы их микоризные партнеры (Essene et al., 2017). В целом, большинство видов деревьев в этих сверхразнообразных лесах также ассоциируются с грибами AM, как и в большинстве тропических лесов (Mcguire et al., 2008). Диптерокарпы становятся прямой мишенью путем выборочной вырубки из-за их коммерческой ценности в качестве древесины (Appanah and Turnbull, 1998), уступая место появлению других древесных пород, которые, вероятно, будут формировать AM (Mcguire et al., 2008). Недавнее исследование выявило влияние таких изменений сообществ деревьев на распределение чистой первичной продуктивности (NPP) (Riutta et al., 2018), с переходом от пологовой АЭС к древесным фракциям АЭС в выборочно вырубленных (SL) низинных диптерокарповых лесах Борнея. Также сообщалось о соответствующих сдвигах в функциональных характеристиках деревьев, что указывает на то, что черты, связанные с захватом и ростом C, более выражены в SL-лесу по сравнению со структурными и устойчивыми характеристиками в старовозрастных (OG) лесах (Both et al., 2019). Эти изменения в структуре надземной продуктивности и функциональных характеристик растений наряду с измененными свойствами почвы из-за лесозаготовок могут иметь серьезные последствия для характеристик грибного сообщества почвенного мицелия (т.е. структура и разнообразие активно питающихся почвенных грибов), на что уже указывают сдвиги, наблюдаемые в сообществах грибов EcM в основной массе почвы с SL (Mcguire et al., 2015), хотя эти взаимосвязи и последующее влияние на продуктивность на сегодняшний день не исследованы. Создание ОП включает преобразование лесов в обширные монокультурные плантации ассоциирующих с AM африканских видов Elaeis guineensis (Phosri et al., 2010; Gaveau et al., 2014) и связано с резкой потерей лесных видов. , серьезно влияющие на биоразнообразие (Fitzherbert et al., 2008; Sodhi et al., 2010; Wilcove et al., 2013). Почвенный микробиом не является исключением: предыдущие исследования документально подтверждают явные различия в бактериальных и грибковых сообществах в OP по сравнению с лесами OG и SL, которые могут быть относительно более похожими (Lee-Cruz et al., 2013; Kerfahi et al., 2014 ; Mcguire et al., 2015). В частности, OP может значительно снизить богатство и относительную численность грибов EcM, которые могут почти полностью отсутствовать в этом землепользовании (Kerfahi et al., 2014; Mcguire et al., 2015). Эти изменения могут иметь серьезные последствия для продуктивности мицелия и связанных с ними функций экосистемы, но последствия остаются нерешенными.

Основная цель этого исследования заключалась в оценке влияния выборочной рубки леса и преобразования лесов в плантации масличных пальм на характеристики и продуктивность мицелиальных грибных сообществ, а также изучение роли свойств почвы и растительности как факторов, влияющих на состав и продуктивность мицелиальных грибных сообществ в тропических регионах. низменные тропические леса диптерокарпия.Мы построили наш эксперимент, чтобы рассмотреть следующие гипотезы:

h2. Атрибуты мицелиальных грибных сообществ будут различаться в зависимости от типа землепользования, с более отчетливыми сообществами в OP по сравнению с лесами OG и SL (Mcguire et al., 2015). Ожидается, что относительная численность EcM будет самой высокой в ​​лесу OG, за которым следуют лес SL и OP (Kerfahi et al., 2014). Это отразится на скорости производства мицелия, которая будет снижаться с интенсивностью нарушения, наряду с удалением деревьев, связанных с EcM.Наблюдаемые различия будут соответствовать изменениям в почвенных и экологических свойствах, составе древесных сообществ и функциональных характеристиках между типами землепользования в результате нарушения.

h3. При использовании лесных угодий атрибуты и продукция мицелиальных грибных сообществ будут объяснены сочетанием свойств почвы и окружающей среды, составом древесного сообщества и функциональными характеристиками (см. Выше).

h4. При использовании лесных земель сдвиги в атрибутах мицелиальных грибных сообществ (особенно микоризных) будут коррелировать со скоростью производства мицелия (Clemmensen et al., 2015; Hagenbo et al., 2018).

Методы

Учебные площадки

Это исследование проводилось в малазийском штате Сабах на севере Борнео. Этот регион характеризуется влажным тропическим климатом со средней дневной температурой 27 ° C и годовым количеством осадков 2600–2700 мм (Walsh and Newbery, 1999; Kumagai and Porporato, 2012). Его расположение в центральной части Юго-Восточной Азии считается сезонным, без четко выраженных влажных или засушливых сезонов (Richards, 1996; Dykes, 1997; Itioka and Yamauti, 2004), хотя здесь наблюдаются нерегулярные межгодовые засушливые периоды, которые в среднем могут составлять ~ 1.4 месяца в году (Walsh and Newbery, 1999; Kumagai et al., 2005). Отбор проб был проведен в общей сложности на девяти участках площадью 1 га в тропических лесах и ОП на низменностях OG и SL (см. Дополнительную информацию 1 для карты мест отбора проб). Четыре участка были распределены по лесу OG: два участка были расположены в заповеднике долины Данум (DVCA) (4,951 °, 117,796 ° и 4,953 °, 117,793 °), а два - в заповеднике бассейна реки Малиау (MBCA) (4,747 °, 116.970 ° и 4.754 °, 116.950 °), закодированные как DAN-04, DAN-05, MLA-01 и MLA-02, соответственно в базе данных ForestPlots (www.forestplots.net). Эти заповедники практически не подверглись антропогенным нарушениям с правовой защитой от вырубки, предоставленной в 1976 и 1981 годах, соответственно (Marsh and Greer, 1992; Hazebroek et al., 2004). Четыре участка были расположены в лесу SL в Калабаканском лесном заповеднике (SAF-01: 4,732 °, 117,619 °; SAF-02: 4,739 °, 117,617 °; SAF-03: 4,691 °, 117,588 ° и SAF-04: 4,765 °, 117,700 °) и один в OP (4,641 °, 117,452 °; Benta Wawasan Sdn. Bdh.) На установленных исследовательских участках в рамках проекта крупномасштабного исследования фрагментации лесов «Стабильность измененных лесных экосистем» (SAFE) (Ewers et al., 2011). Два участка SL были выборочно вырублены дважды и два - четыре раза, причем леса подвергались вырубке древесины сначала в середине 1970-х годов (~ 113 м 3 га -1 вырублено древесины), а затем еще до трех раз в период с 1990 по 2008 г. (~ 37–66 м 3 га −1 кумулятивная вырубка древесины) (Fisher et al., 2011; Riutta et al., 2018). Участок OP был расположен в насаждении возрастом ~ 7 лет на момент отбора проб, где внесение удобрений представляло собой примерно два внесения 3–4 кг мешков пальмы -1 год -1 (включая смесь диаммонийфосфата, калия хлорид, сульфат аммония, сульфат магния и пентагидрат буры) до этого исследования (J.Древер, личное сообщение). Все участки в лесах OG и SL были ранее созданы как часть сети глобального мониторинга экосистем (GEM) (http://gem.tropicalforests.ox.ac.uk/) для долгосрочной оценки круговорота углерода в лесах и продуктивности с тех пор. 2011 (Malhi et al., 2015; Riutta et al., 2018), и недавно были охарактеризованы по комплексу древесных сообществ, признакам растений, микробным сообществам почвы и физико-химическим свойствам почвы (Elias et al., 2018; Both et al., 2019).

Дизайн отбора проб

Три участка размером 20 × 20 м были случайным образом выбраны для каждого участка площадью 1 га для оценки характеристик мицелиального сообщества и продуктивности.На каждый участок в произвольно выбранном месте устанавливали десять мешков для роста гиф. Мешки закапывали с интервалами 50 см вдоль двух параллельных трансект (5 мешков на трансект), расположенных на расстоянии 1 м друг от друга, чтобы обеспечить адекватное извлечение образцов и учесть пространственную изменчивость в составе грибного сообщества и продукции мицелия.

Мешки для роста гиф

Мешки для роста гиф

были сконструированы из двух квадратов размером 5 см × 5 см из мелкопористой нейлоновой сетки (Plastok, Великобритания), запечатанных паяльником.Размер ячеек 41 мкм был выбран, чтобы обеспечить доступ к гифам грибов, но предотвратить проникновение корней растений (Fisher et al., 2013; Wallander et al., 2013). Мешки были заполнены 25 г высушенного в печи, стерилизованного нагреванием кварцевого песка (150 ° C в течение 24 часов). Мешки для выращивания растений устанавливали в период с апреля по май 2016 г. путем закапывания вертикально на поверхность почвы на глубину ~ 0–5 см. Он был выбран для включения органического слоя и границы раздела между органическими и минеральными горизонтами, чтобы максимизировать рост грибов (Lindahl et al., 2007; Wallander et al., 2013). Опад на подстилку, как правило, в этих лесах относительно стабилен в течение всего года, что отражает незначительные межгодовые климатические колебания (Kumagai and Porporato, 2012). Таким образом, ростовые мешки собирали через 6 месяцев, чтобы позволить грибковую колонизацию, а не в течение вегетационного периода, который обычно используется в умеренных или северных системах (Wallander et al., 2013). Пакеты замораживали в полевой лаборатории после сбора и транспортировали на льду в Ланкастерский университет, Великобритания, где их хранили при -20 ° C перед анализом.Мешки были осмотрены и выброшены при явных повреждениях или проникновении корней. Из-за низкого уровня извлечения неповрежденных мешков, три мешка для роста использовались на каждом участке, чтобы учесть локальные вариации в колонизации мицелия (за исключением пяти составных образцов: один собран из двух мешков для роста и четыре из одного мешка из-за высокий уровень повреждений или потерь на некоторых участках). В лаборатории были открыты мешки, песок был осторожно набран на каждую часть и смешан вручную, в результате было получено 27 составных образцов (по три на 1 га) для количественной оценки численности мицелия и молекулярного анализа грибковых сообществ.На участке OP был создан только один участок площадью 1 га из-за логистических проблем и поскольку ожидалось, что пространственная вариация в этом типе землепользования будет низкой (на что указывает низкое бета-разнообразие грибов и вариация в относительной численности EcM в OP по сравнению с OG. и SL на Борнео; Kerfahi et al., 2014). Таким образом, три составных образца OP были обработаны как независимые повторы, каждая из которых представляет собой отдельный образец на уровне графика для всех анализов.

Экстракция гифов и оценка продуктивности мицелия

Гифы были извлечены из песка с использованием адаптированного метода флотации (Bakker et al., 2015). Пятиграммовые образцы переносили в пробирки для образцов объемом 50 мл, затем заполняли до 30 мл 4 М раствором KCl. Этот экстрагент использовался для обеспечения плавучести всех гиф и предотвращения комкования и опускания грибковых нитей, которые могут быть гидрофильными или гидрофобными (Ekblad et al., 2013), предотвращая адекватное отделение от частиц песка (как было обнаружено в предыдущих лабораторных испытаниях с использованием дистиллированной воды. ). Пробирки встряхивали на полной скорости в течение 1 мин, оставляли стоять на 30 с, чтобы позволить материалу гиф достичь поверхности раствора, и 25 мл переливали в чистую пробирку для образца, избегая переноса частиц песка.Этот процесс был повторен еще раз на той же подвыборке песка. Экстракт переносили в сосуд для образца и доводили его до 100 мл, дважды промывая пробирку для образца 25 мл дистиллированной воды. Материал гиф был подготовлен для измерения с использованием метода мембранной фильтрации (Hanssen et al., 1974). Экстракт равномерно перемешивали с использованием смесителя для образцов при 700 об / мин -1 , и аликвоты по 10 мл переносили в два этапа с помощью пипетки на 5 мл во время перемешивания в стеклянную фильтрующую трубку на 15 мл, установленную на нитроцеллюлозной фильтрующей мембране (Merck Millipore , США; 1.Размер пор 2 мкм, диаметр 25 мм). Суспензию фильтровали с помощью вакуумного насоса, и гифы окрашивали в пробирке с использованием лактофенолового хлопкового синего под вытяжным шкафом в течение 20 мин. Затем мембрану фильтра промывали дистиллированной водой до тех пор, пока фильтрат не становился прозрачным, и оставляли сушиться на воздухе в течение ночи. Мембраны фильтров устанавливали на предметные стекла микроскопа с иммерсионным маслом для прозрачности и закрывали покровным стеклом.

Гифы на мембранах фильтров были сфотографированы с высоким разрешением (4080 × 3072 пикселей) с помощью камеры, установленной на микроскопе, при 100-кратном увеличении (Olympus BX51, Olympus DP71), что позволило идентифицировать структуры гиф диаметром ≥ 1 мкм.Фотографии использовались для измерения гиф, чтобы максимально увеличить покрытие мембраны и уловить вариации внутри образца, невозможные при прямом наблюдении под микроскопом при большем увеличении. Двадцать пять фотографий (каждая покрывает площадь ~ 1,53 мм 2 ) были сделаны на каждую мембрану вдоль четырех пересекающихся разрезов, расположенных под 45 ° друг к другу, как описано Boddington et al. (1999). Длина гифы оценивалась по фотографиям с использованием метода пересечения линий сетки (Tennant, 1975). Регулярная сетка размером 50 × 50 мкм помещалась в цифровом виде поверх каждой фотографии с помощью ImageJ (Schneider et al., 2012; Шен и др., 2016). Контраст и яркость изображения были изменены по мере необходимости для улучшения визуализации гиф. Были подсчитаны все пересечения между гифами и линиями сетки, и общая длина гиф была рассчитана с использованием формулы Теннанта. Общую длину гиф в каждой подвыборке оценивали с использованием длины гифы на площадь на фотографиях и площади мембраны, используемой для фильтрации. 10 г свежего песка из каждого композитного образца сушили в печи при 105 ° C до постоянного веса для расчета содержания влаги для стандартизации оценок длины гиф.Затем рассчитывали длину гифа в мм г -1 сухого песка для статистического анализа продукции мицелия.

Характеристики почвы, окружающей среды и растительности

Физико-химические данные почв для соответствующих участков были получены из существующего набора данных (Elias et al., 2018). Вкратце, с марта по апрель 2015 г. было отобрано пять образцов почвы на каждом участке (шнек диаметром 3 см). Глубина органического слоя почвы была измерена до отделения от нижележащей минеральной почвы.Образцы почвы органического слоя были собраны в каждый участок и проанализированы на pH органического слоя, общий C, общий азот (N), общий фосфор (P), неорганический P и текстуру (% песка, ила и глины). pH воды измеряли на свежих почвах с помощью pH-метра (1: 2,5 от почвы к деионизированной воде) после встряхивания в течение ночи при 100 об / м -1 на орбитальном шейкере и выдерживания в течение 30 минут (Landon, 1984). Остальные почвы сушили на воздухе при 40 ° C до постоянного веса и пропускали через сито 2 мм. Части образцов для анализа общего содержания углерода и азота сушили при 65 ° C в течение 48 часов и измельчали ​​до мелкого порошка с помощью пестика и ступки.Общее содержание углерода и азота в почве определяли методом сухого сжигания при 900 ° C с использованием анализатора Elementar Vario Max CN (Elementar Analysensysteme, Ханау, Германия). Образцы переваривали с использованием серной кислоты и перекиси водорода (Allen, 1989) для определения общего количества P. Неорганический P экстрагировали с использованием экстрагента Bray № 1 (Bray and Kurtz, 1945). Содержание P в экстрактах и ​​гидролизатах определяли с использованием метода молибденового синего (Anderson and Ingram, 1993), считывая при 880 нм на спектрофотометре (HITACHI-UV-VIS, Япония).Текстуру почвы измеряли методом пипетки (Miller, Miller, 1987). Насыпную плотность почвы определяли по одному дополнительному образцу, взятому на подучастке, с использованием мерного кольца диаметром 7,5 см, высушенного при 105 ° C в течение 24 часов после удаления корней и камней (Emmett et al., 2008). Значения влажности почвы (верхний слой 12 см), температуры (глубина 10 см) и температуры воздуха (20 см над поверхностью почвы) для соответствующих участков были получены из наборов данных непрерывного отбора проб участков GEM, как описано в Marthews et al.(2014). Измерения наклона проводились при сборе мешка для роста с использованием клинометра в каждом углу и центре участка, а значения усреднялись на уровне участка. Высота записывалась с использованием GPS в центре каждого участка. Структурные характеристики леса [плотность ствола, базальная площадь, средний и максимальный диаметр стволов на высоте груди (DBH) ≥ 10 см, доля первого дерева в базальной площади и индекс площади листа (LAI)] и показатели продуктивности деревьев [первичная чистая площадь полога производство (NPP), древесная NPP, корневая NPP, общая NPP] для соответствующих участков также были доступны из наборов данных графиков GEM с использованием усредненных по времени данных, собранных в период с 2011 по 2016 год (Marthews et al., 2014; Riutta et al., 2018). Наборы данных по таксономическим сообществам деревьев были построены на уровне участка площадью 1 га из предыдущего исследования, проведенного в июле-декабре 2015 г., когда все отдельные деревья DBH ≥ 10 см на трех участках размером 20 × 20 м были таксономически идентифицированы (Both et al., 2019). Базальная площадь диптерокарпия была получена из данных по сообществам деревьев на уровне делянки.

Молекулярный анализ грибковых сообществ мицелия и предварительная обработка данных

ДНК

экстрагировали из 0,2 г песка из пакетов для выращивания с использованием набора для выделения ДНК PowerSoil ® и протокола (MoBio Laboratories).Библиотеки ампликонов были сконструированы в соответствии со стратегией двойного индексирования с каждым праймером, состоящим из соответствующего адаптера Illumina, индексной последовательности из 8 нуклеотидов, последовательности площадок из 10 нуклеотидов, 2-нуклеотидного линкера и праймера, специфичного для ампликона (Kozich et al., 2013 ). Грибы были мишенью для амплификации области ITS2 с использованием праймеров GTGARTCATCGAATCTTTG и TCCTCCGCTTATTGATATGC (Ihrmark et al., 2012). Хотя возможность обнаружения AM-грибов с использованием праймеров ITS обсуждается (Hart et al., 2015), недавние исследования показали, что закономерности разнообразия и состава сообществ могут быть адекватно идентифицированы в типах образцов, таких как почва (Berruti et al., 2017; Lekberg et al., 2018). Ампликоны были созданы с использованием высокоточной ДНК-полимеразы (Q5 Taq, New England Biolabs). После начальной денатурации при 95 ° C в течение 2 минут условия ПЦР были следующими: денатурация при 95 ° C в течение 15 с; отжиг при 52 ° С; время отжига 30 с, удлинение при 72 ° C 30 с; количество циклов было 25; было включено последнее продление на 10 мин при 72 ° C. Размеры ампликонов определяли с использованием системы Agilent 2200 TapeStation, образцы нормализовали с использованием набора для нормализации SequalPrep (Thermo Fisher Scientific) и объединяли.Объединенную библиотеку количественно оценивали с использованием набора Qubit dsDNA HS (Thermo Fisher Scientific) перед секвенированием с помощью Illumina MiSeq с использованием реагентов цикла V3 600 в концентрации 8 пМ с 5% контрольной библиотекой PhiX Illumina. Цикл секвенирования произвел более 18 миллионов считываний, прошедших фильтр. Последовательности обрабатывались в R (R Core Team, 2013) с использованием пакета DADA2 для качественной фильтрации, слияния, устранения шума и назначения таксономий (Callahan et al., 2016). Чтения последовательности были обрезаны до 225 и 160 оснований, вперед и назад, соответственно.Параметры фильтрации: максимальное количество Ns (maxN) = 0, максимальное количество ожидаемых ошибок (maxEE) = 1. Последовательности были дереплицированы, и был применен алгоритм вывода вариантов основной последовательности DADA2 . Функции mergePairs и removeBimeraDenovo использовались с настройками по умолчанию для объединения прямого и обратного чтения и удаления химерных последовательностей. Варианты последовательностей ампликонов (ASV) были подвергнуты таксономическому назначению с использованием assignTaxonomy и обучающей базы данных UNITE версии 7.2 (UNITE Community, 2017).

функциональных гильдейских классификаций грибов были присвоены ASV с помощью инструмента аннотации FUNGuild (Nguyen et al., 2016). Для анализа рассматривались только ASV с однозначной (не множественной) классификацией «вероятного» или «весьма вероятного» доверительного ранжирования. Они использовались для расчета относительной численности грибных гильдий и подгруппы наборов данных по сапротрофным, микоризным и патогенным грибам для оценки разнообразия и различия сообществ (разнообразие грибов EcM и AM и различия сообществ не могли быть проанализированы отдельно из-за отсутствия подсчета считывания в количество образцов).Данные секвенирования были предварительно обработаны (шаги описаны ниже), а индексы альфа-разнообразия (ASV-богатство, индекс Шеннона) и относительная численность грибных гильдий рассчитаны в R версии 3.5.1 (R Core Team, 2013) с использованием пакета phyloseq (Mcmurdie and Холмс, 2013). Только ASV, отнесенные к царству грибов, были оставлены для последующего анализа (99,34% от общего числа считываний), а все одноэлементные ASV были удалены. Подгруппа грибковых гильдий проводилась на полном наборе необработанных данных, чтобы максимизировать количество считываний ASV, доступных для анализа функциональных групп.Глубина секвенирования образцов была нормализована для каждой группы путем разрежения до минимального количества считываний 4881, 151, 75 и 67 на образец для общей, сапротрофной, микоризной и патогенной групп грибов, соответственно. Анализы показателей разнообразия и различий сообществ были повторены с использованием нерешенных и разреженных наборов данных только для всей выборки (до подгруппы грибковых групп), которые показали в целом согласованные результаты.

Статистический анализ

Все статистические анализы проводились в R версии 3.5.1 (R Core Team, 2013), а значимость учитывалась на уровне p ≤ 0,05. Для одномерного анализа были построены линейные регрессионные модели со смешанными эффектами (LMM) в пакете lme4 R (Bates et al., 2015). Это включало тестирование (h2) влияния типа землепользования на относительную численность гильдий мицелиальных грибов и альфа-разнообразие, производство мицелия и почвы, характеристики окружающей среды и растительности, а также (h3 и h4) отношения между этими переменными на участках OG и SL. Post-hoc попарные сравнения были проведены с пакетом emmeans R (Lenth et al., 2019) с поправкой Бонферрони для выявления статистически различных средних значений переменных между типами землепользования OG, SL и OP. Чтобы контролировать потенциальную псевдорепликацию внутри участка, идентификатор участка был включен как случайный член пересечения. Значимость оценивалась с использованием приближения степеней свободы Саттертуэйта (Luke, 2017). Нормальность остатков модели оценивалась с использованием критериев Шапиро-Уилка, а переменные преобразовывались в логарифмическую и экспоненциальную формы, если это необходимо для улучшения соответствия модели.Тесты Краскела-Уоллиса проводились, когда не удавалось удовлетворительно достичь остаточной нормальности с использованием данных, усредненных на уровне графика.

Состав грибного сообщества мицелия во всех типах землепользования был визуализирован с помощью PCoA с использованием различий Брея-Кертиса с помощью пакетов phyloseq, vegan (Oksanen et al., 2019) и ggplot2 (Wickham, 2016). Чтобы проверить различия в составе грибных сообществ между OG, SL и OP (h2), различия сообществ Брея-Кертиса были рассчитаны на основе данных, усредненных на уровне графика ( n = 11) с использованием функции merge_samples в phyloseq .Различия между типами землепользования были протестированы с помощью PERMANOVA с использованием функции adonis vegan , а статистически разные группы были выявлены с помощью функции pairwise.adonis в пакете pairwise Adonis R (Martinez Arbizu, 2019) с учетом коэффициента ложного обнаружения ( FDR). Все перестановочные тесты были запущены с 9999 перестановками, за исключением попарных множественных сравнений, где использовалось полное перечисление. Индикаторный анализ был проведен для выявления конкретных таксонов грибов, связанных с различными типами землепользования, с использованием пакета labsdv R (Dufrêne and Legendre, 1997; Roberts, 2016).Различия в составе древесных сообществ между лесами OG и SL (h2) были протестированы с помощью PERMANOVA с использованием различий сообществ Брея-Кертиса, рассчитанных на основе данных сообщества на уровне участка. Преобразование Хеллингера применялось ко всем данным сообщества до многомерного анализа (Legendre and Borcard, 2018), чтобы контролировать влияние редких таксонов. Однородность многомерной дисперсии по типам землепользования (предположение PERMANOVA) для различий грибных и древесных сообществ оценивалась с использованием функции betadisper vegan для общих и попарных тестов (с поправкой на FDR).

Взаимосвязи между составом мицелиальных грибных сообществ и характеристиками почвы, окружающей среды и растительности (h3) на лесных участках (OG и SL) были оценены с использованием анализа избыточности на основе расстояния (db-RDA). В анализ был включен состав сообщества деревьев, представленный первыми тремя осями PCoA, что объясняет большую часть вариации (кумулятивные собственные значения 60,39%). Перед анализом сильно коррелированные переменные в 1) группах почвы и окружающей среды и 2) растительности были идентифицированы с помощью коррелограмм с использованием пакета corrplot R (Wei and Simko, 2017).Переменные, коррелирующие с r ≥ ~ 0,7 Пирсона, были удалены. Переменные почвы и окружающей среды рассматривались как одна группа, поскольку характеристики почвы рассматривались как имеющие первостепенное экологическое значение, будучи обусловлены факторами окружающей среды. Лучшие предикторы грибковых различий Брея-Кертиса были определены путем прямого отбора с использованием критериев скорректированного R 2 и уровня значимости p <0,05 (Blanchet et al., 2008) с функцией ordiR2step vegan .Здесь различия Брея-Кертиса были рассчитаны на уровне подзаголовка, а перестановочные тесты были ограничены идентификатором участка, чтобы контролировать дизайн вложенной выборки с использованием пакета permute R (Simpson et al., 2019). Различия в различиях грибкового сообщества были разделены по компонентам почвы, окружающей среды и растительности с использованием функции varpart, а значимость компонентов и индивидуальных предикторов была проверена с частичным db-RDA в vegan . Отношения между мицелиальными грибковыми и растительными сообществами (h3) были протестированы с использованием различий Брея-Кертиса на уровне участков с тестами Мантеля (ранговая корреляция Спирмена) в вегетарианском .Взаимосвязь между составом мицелиального грибкового сообщества и продуцированием мицелия (h4) была протестирована с помощью PERMANOVA с использованием различий Брея-Кертиса и той же схемы перестановок, описанной выше.

Результаты

В целом, 3565 грибковых ASV из 10 типов (рис. 1) и 374 родов были обнаружены во всех образцах леса OG, леса SL и OP. Из ASV, которые были отнесены к функциональным гильдиям грибов, большинство считываний были сапротрофными (39,9%), за которыми следовали микоризные [27.0%: 83,1% из них EcM; 16,7% AM; 0,2% эрикоидных микоризных (ErM)], патогенных (21,0%: 51,4% из них патогенных для животных; 48,6% патогенных для растений), паразитарных (7,1%), эндофитных (2,2%), лихенизированных (2,0%) и эпифитных (0,7%) грибы.

Рисунок 1 . Относительная численность филы мицелиальных грибов в процентах от общего количества вариантов последовательности ампликонов (ASV) в старовозрастных (OG) и выборочно вырубленных (SL) низинных тропических лесах диптерокарповых и плантациях масличных пальм (OP) в Сабахе, Борнео, для (A) в целом, (B) сапротрофные, (C) микоризные группы грибов.Типы с относительной численностью <1% по всем типам лесопользования представлены как одна группа для грибов в целом. (D) Относительная численность классов мицелиальных патогенных грибов. Типы для этой группы грибов не показаны, так как среди ридов преобладает один тип (Ascomycota: 98,76% в OG, 100% в SL и 99,38 в OP), а остальные чтения составляют таксоны Basidiomycota.

h2 - Влияние типа землепользования на атрибуты мицелиальных грибных сообществ, продуктивность мицелия и характеристики почвы, окружающей среды и растительности

Тип землепользования существенно повлиял на различия сообществ в отношении общих, сапротрофных, микоризных и патогенных групп грибов (Рисунки 2A – D; см. Таблицу 1 для обобщения статистики).Парные сравнения выявили значительные различия между лесопользованием и лесопользованием в отношении общих различий и различий в патогенных грибных сообществах. Не было обнаружено значительных различий между типами землепользования в отношении различия сапротрофных или микоризных сообществ при попарных сравнениях ( p > 0,05). Однако дальнейшие испытания с использованием только участков OG и SL не показали значительного влияния типа землепользования на различия сапротрофных или микоризных сообществ (PERMANOVA: p = 0.223; p = 0,115, соответственно), что указывает на то, что OP является драйвером значительного эффекта, обнаруженного по всему градиенту нарушения для этих групп грибов. Дисперсии различий в сообществах были однородными для всех типов землепользования для всех групп грибов (бетадиспер: p > 0,05). Не было обнаружено значительных различий в различиях сообществ или показателях альфа-разнообразия (богатство ASV и индекс Шеннона) между OG и SL для любой группы грибов ( p > 0.05), несмотря на значительные различия в свойствах почвы, окружающей среды и растительности между лесными землепользованиями (средние значения по типу землепользования приведены в Таблице 2; статистические данные о значительных различиях приведены в Дополнительной информации 2). Однако относительная численность AM-грибов была значительно выше в SL по сравнению с OG (Рисунок 3), а относительная численность грибов ErM была выше в SL по сравнению со всеми другими типами землепользования (Рисунок 3) (средние значения для всех мицелиальных грибов см. В Таблице 3). атрибуты сообществ по типу землепользования; статистические данные о значимых различиях представлены в таблице 4).Общая относительная численность патогенных грибов была незначительно значимо выше в SL по сравнению с OG при тестировании без образцов OP ( F = 4,25, R 2 = 0,16, p = 0,051). Подавляющее большинство микоризных считываний было отнесено к грибам EcM на лесных участках (89,6%: 98,31% в OG; 80,90% в SL), но в основном это были AM-грибы в OP (69,4% AM; 30,6% EcM). Общая относительная численность микоризных грибов и грибов EcM была значительно ниже в OP по сравнению с лесными участками (Рисунок 3).Средняя относительная численность паразитических грибов была на порядок выше в OP по сравнению с OG и SL, хотя не было обнаружено значительных различий между типами землепользования из-за значительных различий в образцах OP ( post-hoc тестов: p > 0,05). Что касается показателей альфа-разнообразия, только на богатство ASV микоризных грибов существенно влияет тип землепользования ( F = 5,80, R 2 = 0,33, p = 0,025; Рисунок 4A), с более низкими значениями в OP по сравнению с в лесные участки (ОГ — ОП: п = 0.028; SL — OP: p = 0,018). Индексы альфа-разнообразия (богатство ASV, индекс Шеннона) не различались между OG и SL для любой группы грибов ( апостериорных тестов : p > 0,05). Индикаторный анализ выявил, что некоторые таксоны грибов семейств Aspergillaceae, Sporocadaceae и Nectriaceae наиболее характерны для леса OG, тогда как таксоны Ophiocordycipitaceae характерны для леса SL, а Nectriaceae, Aspergillaceae и Ophiocordycipitaceae характерны для OP (дополнительная информация 3).

Рисунок 2 . Анализ основных координат (PCoA) ординации (A) в целом, (B) сапротрофного, (C) микоризного и (D) патогенного мицелиального грибкового сообщества различий Брея-Кертиса между старовозрастными (OG) и старовозрастными (OG) и выборочно вырубленные (SL) низинные тропические леса диптерокарпия и плантации масличных пальм (OP) в Сабахе, Борнео. Баллы масштабируются по длине гифы, указывающей на продукцию мицелия. Эллипсы представляют t - достоверность распределения для OG выборочно SL леса.Эллипсы не включаются в выборки OP из-за количества выборок ( n = 3). Для несходства микоризного грибкового сообщества (C) две точки OP неразличимы (значения длины гиф 0,24 и 0,84 мг -1 соответственно) из-за одинаковых оценок PCoA для осей 1 и 2 (координаты: 0,32, -0,12) .

Таблица 1 . PERMANOVA проверяет статистику различий в различиях грибковых сообществ гильдий по типам землепользования: старовозрастные (OG) и селективно вырубленные (SL) низинные тропические леса диптерокарпия и плантации масличных пальм (OP) в Сабахе, Борнео.

Таблица 2 . Средние (± 1 SD) характеристики почвы, окружающей среды и растительности по типу землепользования для старовозрастных (OG) и выборочно вырубленных (SL) низинных тропических лесов из диптерокарпия и плантации масличных пальм (OP) в Сабахе, Борнео.

Таблица 3 . Среднее (± 1 стандартное отклонение) продукция мицелия (длина гифы) и атрибуты грибковой гильдии (богатство варианта последовательности ампликона (ASV), альфа-разнообразие Шеннона и относительная численность) по типу землепользования для старовозрастных (OG) и выборочно зарегистрированные (SL ) низменные тропические леса диптерокарпия и плантации масличных пальм (OP) в Сабахе, Борнео.

Таблица 4 . Линейная смешанная модель (LMM) тестирует статистику значительных различий в относительной численности грибных гильдий по типам землепользования старовозрастных (OG) и выборочно вырубленных (SL) низинных тропических лесов диптерокарпия и плантаций масличных пальм (OP) в Сабахе, Борнео.

Рисунок 3 . Относительное обилие грибных гильдий в старовозрастных (OG) и выборочно вырубленных (SL) низинных тропических лесах диптерокарпия и плантации масличных пальм (OP) в Сабахе, Борнео. Планки погрешностей представляют собой стандартные ошибки.Строчные буквы указывают на статистически разные или похожие группы по всем трем типам землепользования, идентифицированные с помощью апостериорных тестов после линейного смешанного моделирования или анализа Краскела-Уоллиса ( p <0,05). Микоризные и патогенные гильдии были далее разделены на подтипы, как указано.

Рисунок 4. (A) Вариант последовательности микоризного ампликона (ASV) и продуктивность мицелия (B) (длина гифа) в старовозрастных и выборочно вырубленных низинных тропических лесах диптерокарпия и плантации масличных пальм в Сабахе, Борнео.Строчные буквы указывают на статистически разные или похожие группы по всем трем типам землепользования, выявленные с помощью апостериорных тестов ( p <0,05). Значения показаны в логарифмической шкале, чтобы представить различия, соответствующие статистическим тестам.

Значения длины гифа варьировались от 0,24 до 8,50 м. Г −1 сухого песка поперек градиента возмущения и существенно зависели от типа землепользования ( F = 6,50, R 2 = 0.33, p = 0,006; Таблица 3; Рисунок 4B). Значения длины гифов были значительно ниже в OP по сравнению с типами лесопользования (OP – OG: p = 0,007; OP-SL: p = 0,008), но существенно не различались между OG и SL ( p = 0,999).

По сравнению с OG, значительно более высокие значения были связаны с SL для насыпной плотности почвы, высоты и доли видов-первопроходцев, и более низкие значения для LAI и полога, древесных растений и общего NPP (Таблица 2; Дополнительная информация 2).Корневая NPP, содержание глины в почве и глубина органического слоя в OP были значительно ниже по сравнению с SL, в то время как содержание ила в почве было значительно выше. Насыпная плотность грунта OP была значительно выше, чем OG. Общий и неорганический почвенный P был на порядок выше в OP по сравнению как с OG, так и с SL. В то время как плотность ствола была значительно ниже в OP по сравнению с обоими типами леса, базальная площадь и средний диаметр ствола были значительно выше в OP. Максимальный диаметр ствола также был выше у OP по сравнению с SL, однако все они принадлежали к одному и тому же виду масличной пальмы.Различия между сообществами деревьев на уровне участков значительно различались между OG и SL (PERMANOVA: F = 1,43, R 2 = 0,19, p = 0,028; бетадиспер: p > 0,05).

h3 и h4 - Взаимосвязи между атрибутами лесных мицелиевых грибных сообществ, почвенными, экологическими и растительными характеристиками и производством мицелия

В целом, различия в сообществах сапротрофных, микоризных и патогенных грибов были в значительной степени связаны с характеристиками почвы и растительности, хотя общая объясненная дисперсия была низкой для каждой группы (см. Таблицу 5 для обобщения статистики).Лучшими предикторами, выбранными для общей несходства грибкового сообщества, были pH почвы и LAI. Из них pH почвы отрицательно связан с относительной численностью патогенных грибов животных ( F = 8,63, R 2 = 0,27, p = 0,008), в то время как LAI отрицательно связан с относительной численностью грибов AM ( F = 8,04, R 2 = 0,28, p = 0,015). Единственным предиктором, выбранным для несходства сапротрофного сообщества, был почвенный неорганический P, в то время как лучшими предикторами несходства сообщества микоризных грибов были pH и базальная площадь диптерокарпия.PH почвы, ось 2 PCoA сообщества деревьев, площадь основания деревьев и неорганический P почвы были идентифицированы как предикторы несходства патогенного грибкового сообщества. Несходство сообществ деревьев на уровне участков было значимо связано с различиями сообществ микоризных грибов на уровне участков ( r = 0,55, p = 0,015; рис. 5), но не с другой группой грибов ( p > 0,05). Различия между диптерокарповыми и микоризными сообществами грибов не были существенно связаны на уровне участков ( p > 0.05). Дополнительные тесты не показали значимой связи между относительной численностью грибов EcM или AM и содержанием углерода в почве ( p > 0,05).

Таблица 5 . Наилучшие характеристики почвы, окружающей среды и растительности в качестве предикторов различий между группами грибов в старовозрастных и выборочно вырубленных низинных тропических лесах диптерокарпия в Сабахе, Борнео, определенные путем прямого отбора (скорректировано R 2 и p > 0,05) на расстоянии- анализ избыточности на основе (db-RDA).

Рисунок 5 . Связь между ранжированным деревом и микоризным сообществом. Различия Брея-Кертиса в старовозрастных и выборочно вырубленных низинных тропических лесах диптерокарпия в Сабахе, Борнео. Статистические данные предоставлены тестом Мантеля с ранговой корреляцией Спирмена. Значение r представляет собой коэффициент Мантеля, а уровень значимости был рассчитан с использованием 9 999 перестановок.

Длина гифа не была достоверно связана с какими-либо атрибутами мицелиального грибного сообщества (h4), хотя отрицательная связь с относительной численностью грибов EcM была незначительной ( F = 3.57, R 2 = 0,13, p = 0,072). Не было значимой связи между длиной гифа и какими-либо измеренными свойствами растительности (h3), включая показатели продуктивности деревьев, но была достоверно положительно связана с неорганическим P в почве ( F = 5,25, R 2 = 0,19, p = 0,032; рисунок 6). Тем не менее, связь между длиной гифа и неорганическим P в почве была в первую очередь обусловлена ​​одной точкой отбора проб в SL-лесу с высокими значениями обоих параметров (Рисунок 6) и оказалась несущественной, когда эта точка данных была исключена из анализа ( F = 0.83, R 2 = 0,04, p = 0,371).

Рисунок 6 . Взаимосвязь между производством мицелия (длина гифы) и концентрацией неорганического P в почве в старовозрастных (OG) и выборочно вырубленных (SL) низинных тропических лесах диптерокарпия в Сабахе, Борнео. Значения длины гиф показаны в логарифмической шкале, соответствующей статистическим тестам. Эта взаимосвязь оказалась несущественной, когда точка данных с высокими значениями обоих параметров (вверху справа) была исключена из анализа ( F = 0.83, R 2 = 0,04, p = 0,371).

Обсуждение

Мы не обнаружили значительных сдвигов в структуре сообществ какой-либо группы мицелиальных грибов между лесами OG и SL (Рисунки 2A – D), несмотря на явные различия в свойствах почвы и растительности (более высокая объемная плотность почвы, доля пионерных деревьев, древесные и общие NPP , а также более низкие значения LAI и NPP в лесном лесу) и состав сообщества деревьев на уровне участка, что в целом соответствует предыдущим результатам, полученным на этих участках исследования (Riutta et al., 2018; Оба и др., 2019). Этот вывод контрастирует с нашей гипотезой (h2) и недавними исследованиями, которые показали, что состав основных сообществ почвенных грибов в тропических диптерокарповых лесах Юго-Восточной Азии очень чувствителен к вырубке (Kerfahi et al., 2014; Mcguire et al., 2015). Наши результаты показывают, что активно питающиеся грибы могут быть более устойчивыми к нарушениям, чем более широкое грибное сообщество в насыпной почве. Однако прямая сопоставимость с другими исследованиями может зависеть от методологических различий в выборке, связанных с коэффициентами отлова сообществ (Wallander et al., 2001; Экблад и др., 2013; то есть микроклиматические условия внутри мешков для выращивания, потенциально способствующие развитию определенных видов грибов). Мы также подчеркиваем, что метод врастающего мешка восстанавливает только активные гифы, что позволяет избежать смешивающего воздействия реликтовой ДНК на паттерны почвенных микробных сообществ, которые могут быть проблемой в исследованиях, связанных с градиентами окружающей среды (Lennon et al., 2018). Общее количество обнаруженных ASV было ниже, чем обнаружено в других недавних исследованиях ITS по секвенированию ампликонов в массовых сообществах почвенных грибов в регионе, которое может превышать 25000 (Элиас, неопубликованные данные), что мы аналогичным образом связываем с этими причинами.Мы идентифицировали различия в других атрибутах мицелиальных грибов между лесами OG и SL, включая значительное увеличение относительной численности грибов AM и ErM в лесу SL. Подавляющее большинство считываний лесной микоризы приходится на грибы EcM (рис. 3). В пологе равнинных тропических лесов Борнео обычно преобладают виды, принадлежащие к Dipterocarpaceae, которые относятся к семейству, ассоциированному с EcM (Taylor and Alexander, 2005; Brearley, 2012). Хотя наш результат может относиться к присутствию видов деревьев-хозяев, высокая EcM по сравнению с относительной численностью AM грибов также может быть результатом систематической ошибки амплификации, связанной с праймерами ITS (Hart et al., 2015). Хотя средняя базальная площадь диптерокарпия (Таблица 2) и относительная численность грибов EcM (Таблица 3; Рисунок 3) были ниже в SL-лесу, мы не обнаружили значительных различий в обоих показателях из-за высокой изменчивости обоих. Тем не менее, мы рассматриваем относительное увеличение численности грибов AM и ErM в лесу SL (единственные идентифицированные другие типы микоризы; рис. 3) как указание на повышение однородности микоризных типов и уменьшение доминирования грибов EcM. Эта закономерность отражает различия в растительности, на что указывает увеличившаяся доля видов-первопроходцев, не являющихся диптерокарповыми, в лесах SL, которые обычно образуют арбускулярную микоризу (Mcguire et al., 2008). Этот сдвиг может иметь последствия для круговорота питательных веществ и углерода, поскольку недавние коррелятивные исследования показали, что сообщества с преобладанием EcM, а не AM могут способствовать хранению углерода в почве в глобальном масштабе (Averill et al., 2014) благодаря своей способности получать доступ к азоту и фосфору. (Liu et al., 2018) из органических источников, потенциально конкурируя со свободноживущими разложителями почвы, нуждающимися в азоте для разложения органических веществ (Averill et al., 2014). Таким образом, увеличение относительной численности AM-грибов может иметь последствия для высвобождения углерода из почвы, поскольку азот становится более доступным для почвенных сапротрофов.Однако наш анализ не выявил связи между относительной численностью грибов EcM и концентрацией углерода в почве. Возможно, что закономерности, описанные в других исследованиях (например, Averill et al., 2014), отражают гораздо более длительные временные рамки доминирования определенного типа микоризы, чем в нашем исследовании. Наблюдались изменения в процессах круговорота углерода в почве в лесах SL dipterocarp, хотя было обнаружено, что разложение подстилки в лесу SL замедлено из-за незначительных изменений в микроклиматических условиях леса (Both et al., 2017), общие последствия для биогеохимического цикла и функций экосистемы неясны.

Общая структура грибного сообщества внутри врастающих мешков значительно различалась между плантациями OP и лесами OG и SL, а также наблюдалось влияние OP как фактора различий по типам землепользования для сапротрофных, микоризных и патогенных мицелиальных грибных сообществ ( Рисунки 2A – D), которые подтверждают влияние преобразования лесов на грибковые сообщества почвы в целом (Mcguire et al., 2015). Богатство микориз также сильно пострадало (рис. 4A), при этом значения в масличной пальме намного ниже, чем на лесных участках. Поскольку мы не обнаружили различий между лесами OG и SL, в целом сообщества мицелиальных грибов, по-видимому, следуют той же схеме, что и сообщества почвенных бактерий, которые, как было показано, в целом не подвержены влиянию лесозаготовок, но заметно отличаются на плантациях масличных пальм (Lee-Cruz et al. , 2013; Tripathi et al., 2016).

В отличие от ожиданий (h2), продукция мицелия существенно не различалась между лесами OG и SL, но была значительно меньше по OP по сравнению с обоими типами лесопользования (Рисунок 4B).Мы также обнаружили, что длина гиф не соответствовала сдвигам в атрибутах мицелиальных сообществ, свойствах почвы и сообществах растительности между SL и OG лесом, что может отражать устойчивость некоторых функций почвы к выборочным рубкам (например, активность ферментов; Mcguire et al., 2015) . Устойчивость как продукции мицелия, так и относительная численность мицелиальных грибов EcM предполагает, что их внематрический мицелий может в значительной степени сохраняться в SL-лесу, когда остаются отдельные хозяева. Сети микоризного мицелия имеют решающее значение для приживления проростков деревьев (Nara, 2006) и могут способствовать обмену ресурсами между растениями с деревьями, имеющими одинаковые микоризные партнерства (Gorzelak et al., 2015). Наши результаты указывают на последствия для потенциального восстановления этих деградированных лесов, поскольку мицелиальные сети EcM, жизненно важные для поддержки пополнения и выживания диптерокарпов, могут сохраняться даже после удаления особей этого семейства. Хотя базальная площадь была значительно выше при OP, мы обнаружили значительно более низкое среднее значение NPP корня при OP по сравнению с SL (таблица 2). Произошло также полное удаление видов диптерокарпия путем преобразования леса в сельскохозяйственные плантации. Кроме того, хотя NPP на пологе не измерялась на участке OP, значительно меньшая глубина органического слоя почвы (Таблица 2) может указывать на уменьшение поступления подстилки, особенно потому, что мертвые пальмовые листья обычно удаляются и собираются на определенных участках, что является стандартом для OP.Это предполагает сочетание отсутствия грибов EcM из-за замещения AM-ассоциированными видами масличных пальм (Phosri et al., 2010), уменьшение подземного выделения C деревьями и снижение поступления органических веществ, что может снижать скорость производства мицелия. в этом типе землепользования. Это соответствует десятикратному увеличению доступности ограничивающих питательных веществ (неорганический P; Таблица 2) в OP из-за использования удобрений. Поскольку плантация OP была создана после выборочной вырубки этих лесов, более низкие значения длины гиф, численность и богатство микоризы, по-видимому, являются результатом масштабов удаления хозяев EcM, а не времени, прошедшего с момента нарушения.Значительное сокращение почвенного (микоризного) мицелия из-за крайнего нарушения преобразования лесов представляет собой существенное препятствие для восстановления этих систем.

В лесах OG и SL атрибуты мицелиальных грибов значительно варьировались в зависимости от свойств растительности и почвы (h3), но не соответствовали продукции мицелия (h4). Было показано, что сообщество почвенных микробов, особенно грибов, коррелирует с таксономической и филогенетической структурой надземных растений в дополнение к местным свойствам почвы (Barberán et al., 2015). PH почвы был важным предиктором состава сообщества для всех групп грибов, особенно микоризных и патогенных грибов, что наблюдается во многих масштабах в экосистемах умеренного пояса (Dupont et al., 2016). На структуру сообщества микоризных грибов неожиданно не повлияла текстура почвы, которая, как ранее было установлено, является сильным предиктором сообществ EcM в тропических лесах дистерокарповых низменностей Борнеи (Essene et al., 2017). Возможно, что использование песка внутри мешков для выращивания маскировало влияние насыпной текстуры почвы.Структура сообщества деревьев и микоризных грибов значимо коррелировала на уровне делянки (рис. 5), вероятно, благодаря значимой взаимосвязи между несходством микоризных грибов и общей базальной площадью диптерокарпия (таблица 5). Предыдущие исследования в диптерокарповых тропических лесах Борнеской низменности показали, что сообщества грибов EcM связаны с сообществом видов диптерокарпий в дополнение к сильному влиянию свойств почвы, предполагая, что распределение видов диптерокарпий по разным типам почвы опосредуется совокупностью их микоризных партнеров (Essene et al., 2017). Тем не менее, мы не обнаружили значительной корреляции между различиями микоризных грибов и сообществ диптерокарпов, что указывает на то, что общая численность, а не состав диптерокарпов более важна для структурирования сообществ активно питающихся микоризных грибов в настоящем исследовании.

Продуктивность мицелия была значительно положительно связана с почвенным неорганическим P (Рисунок 6), хотя ранее было показано, что биомасса мицелия больше в лесах с большим дефицитом фосфора (Potila et al., 2009). Однако в некоторых случаях распространение микоризных гиф в «горячие точки» питательных веществ наблюдалось как в лабораторных экспериментах, так и в природных системах (Ekblad et al., 2013), в то время как роль неорганического фосфора в контроле скорости производства мицелия была продемонстрирована в леса с использованием мешков для роста гиф, обогащенных минералом P, и полевые манипуляции с использованием удобрений (Hagerberg et al., 2003; Potila et al., 2009; Ekblad et al., 2013; Camenzind et al., 2016). В текущем исследовании слабая природа этой взаимосвязи (в основном обусловленная одной точкой выборки в SL; Рисунок 6) ограничивает интерпретацию основных механизмов, и к ней следует подходить с осторожностью.Для подтверждения этой связи требуется дальнейшее исследование, которое может быть достигнуто с помощью изменений в схеме выборки, обсуждаемых ниже.

Следует признать некоторые ограничения в отношении интерпретации результатов в этом исследовании. В первую очередь, отбор проб почвы проводился за 12-14 месяцев до установки и за 18-20 месяцев до сбора гифальных мешков для роста. Любые изменения в свойствах почвы, вызванные климатическими факторами, динамикой растительности (например, возобновлением SL леса) или управлением OP в течение этого периода, не учитывались.В отличие от тропических лесов в других тропических регионах, в лесах Борнео нет определенного влажного или засушливого сезона (Richards, 1996; Dykes, 1997), что отражается в относительно стабильном производстве подстилки в течение года (Kumagai and Porporato, 2012). Не ожидается, что различия во времени года, в которых отбираются пробы, будут иметь заметный эффект (то есть из-за связанной сезонной динамики количества подстилки, обусловленной выпадением осадков, состояния почвы и микробных сообществ почвы, наблюдаемых в других тропических системах; Buscardo et al., 2018), хотя следует отметить потенциальное влияние надгодовых климатических и фенологических колебаний (Itioka and Yamauti, 2004) и нерегулярных межгодовых засушливых периодов (Walsh and Newbery, 1999; Kumagai et al., 2005). Кроме того, данные о почве представляют собой объемные почвенные условия в масштабе участка (10 × 10 м), а не те, которые находятся в мешках, в которые непосредственно попали грибки. Комбинированное временное и пространственное разделение данных о продуктивности почвенных и грибковых сообществ может лежать в основе общего отсутствия связи, обнаруженной между характеристиками почвы и продуктивностью мицелия (также проблематично для уверенности в наблюдаемых взаимосвязях, т.е. неорганический P; Рисунок 6) или атрибуты грибкового сообщества (например, незначительные общие различия в различиях сообществ, объясняемые почвенными факторами; Таблица 5). Будущие исследования должны быть нацелены на одновременный сбор образцов на предмет физико-химических свойств почвы, сообществ почвенных грибов и продуктивности мицелия (во время установки, инкубации и сбора мешков для прорастания гиф). Соответствующий молекулярный анализ основных сообществ почвенных грибов для сравнения с мешками для роста, в тандеме с временным подходом, поможет подтвердить взаимные механистические взаимосвязи между свойствами почвы и моделями продуктивности сообщества грибов.

В настоящем исследовании были проанализированы данные 27 составных выборок с 9 участков, распределенных по трем типам землепользования в ландшафтном масштабе (дополнительная информация 1). Несмотря на то, что составные образцы включали материал из 72 индивидуальных мешков для роста, чтобы контролировать локальные вариации, неожиданно высокий уровень изменчивости в атрибутах грибкового сообщества и продуктивности мицелия наблюдался в разных землепользованиях (особенно в пределах двух типов леса; Рисунок 4B). Эта изменчивость (Таблица 3) затрудняет установление эффектов (или их отсутствия) управления, и будущие обследования должны включать большее повторение на уровне участков в свете этих результатов.Точно так же влияние участка не может быть исключено из различий, обнаруженных в атрибутах грибных сообществ и продуктивности мицелия между OP и лесными образцами, поскольку репликация была ограничена только одним участком площадью 1 га в этом типе землепользования. В то время как согласованность с предыдущими исследованиями на полуострове Малайзия и Борнео (например, значительное сокращение относительной численности EcM в OP по сравнению с тропическими лесами из диптерокарповых лесов OG и SL; Kerfahi et al., 2014; Mcguire et al., 2015) позволяет предположить, что результаты являются репрезентативными для широкого воздействия преобразования лесов в ОР на активно кормящиеся сообщества грибов, следует с осторожностью относиться к их интерпретации.

Было обнаружено, что метод мешков для роста адекватно отражает продуктивность микоризного мицелия, что продемонстрировано δ 13 C (Wallander et al., 2001) и молекулярным (Kjøller, 2006) анализами мешков в системах с преобладанием EcM. Однако наши результаты показывают, что это может быть не так в тропических лесах, где большая часть всех считываний принадлежит ASV, идентифицированным как сапротрофы. Таким образом, измеренные гифы не могут быть напрямую отнесены к одной группе грибов или микоризному типу в этом исследовании.Включение анализов биомаркеров для разделения биомассы по типам грибов или включение дополнительных мер по снижению проникновения сапротрофного мицелия необходимо для улучшения понимания только микоризной продуктивности (Wallander et al., 2013). Мы обнаружили высокий уровень вариабельности несходства мицелиальных грибных сообществ на лесных участках. Наш анализ был сосредоточен на верхнем слое почвы, так как именно здесь происходит большая часть круговорота питательных веществ. Здесь мелкомасштабная неоднородность окружающей среды может приводить к большей пространственно-временной изменчивости грибных сообществ по сравнению с подстилающей минеральной почвой, где сообщества могут различаться (Bahram et al., 2015). Будущие исследования, учитывающие влияние деградации лесов на мицелиальные грибковые сообщества и продуктивность на разных глубинах почвы, могут выявить различные закономерности по профилю почвы.

В заключение, выборочная рубка леса не привела к значительному изменению структуры или продуктивности мицелиальных грибных сообществ из OG леса, что позволяет предположить, что мицелиальные грибковые сообщества и функции могут быть относительно устойчивыми к деградации леса по сравнению с грибами в основной массе почвы. Результаты показывают, что экстраматрический мицелий EcM в значительной степени сохраняется в выборочно вырубленных лесах, что имеет положительные последствия для потенциального восстановления диптерокарпового леса за счет обеспечения существующих микоризных сетей для приживления саженцев деревьев.Тем не менее, лес SL был связан с более высокой относительной численностью грибов AM и ErM по сравнению с OG, что может иметь последствия для круговорота и накопления углерода в почве в равнинных тропических лесах Борнео в более длительных временных масштабах, чем указанные здесь. Производство мицелия не было связано с какими-либо атрибутами грибкового сообщества и в целом не зависело от характеристик растительности, почвы и окружающей среды, за исключением слабой положительной связи с концентрацией неорганического фосфора в почве. Напротив, было показано, что переустройство земель под плантации масличных пальм оказывает значительное влияние на общие, сапротрофные, микоризные и патогенные структуры сообществ мицелиальных грибов, снижая относительную численность и разнообразие микориз.Производство мицелия масличной пальмы было значительно ниже по сравнению с лесом, что соответствует концентрации неорганического P в почве на порядок выше при этом типе землепользования. Воздействие преобразования лесов на характеристики грибных сообществ и продуктивность мицелия может иметь широкие последствия для динамики питательных веществ, взаимодействия растений с почвой и потенциала восстановления в больших масштабах, поскольку плантации масличных пальм быстро стали основным видом землепользования в Юго-Восточной Азии.

Заявление о доступности данных

Необработанные данные, подтверждающие выводы этой статьи, будут предоставлены авторами без излишних оговорок любому квалифицированному исследователю.Наборы молекулярных данных, созданные для этого исследования, можно найти в Европейском нуклеотидном архиве под номером доступа к исследованию. PRJEB357.

Авторские взносы

SR, DE, DJ, SB, NPM и NO внесли свой вклад в первоначальный концептуальный дизайн исследования. SR и DE создали исследовательские участки и собрали образцы почвы и данные на местах. TG провела анализ последовательности ДНК и биоинформатику для создания набора молекулярных данных. RG и TG представили концептуальный подход к статистическому анализу микробных сообществ.SR, DJ, DE и NPM внесли свой вклад в метод экстракции гиф. DE, NPM и NM провели анализ почвы и предоставили набор данных о характеристиках почвы. SB предоставил древовидное сообщество и набор данных по функциональным признакам. TR предоставляет набор данных о продуктивности деревьев. SR провел статистический анализ и написал первый черновик рукописи. DE, SB, TR, NPM, RG, NO, DJ и TG внесли свой вклад в рукопись. Все авторы представили критическую ревизию интеллектуального содержания и одобрили рукопись для подачи.

Финансирование

Это исследование финансировалось Программой модифицированных человеком тропических лесов Совета по исследованиям окружающей среды Великобритании (NERC) (номер гранта NE / K016377 / 1) и фондом Сайма Дарби для проекта SAFE. Эта публикация является вкладом консорциума NERC «Воздействие биоразнообразия и землепользования на функцию тропических экосистем» (BALI). DJ получает частичную поддержку от программы N8 Agrifood.

Конфликт интересов

Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могут быть истолкованы как потенциальный конфликт интересов.

Благодарности

Мы выражаем благодарность Совету Сабаха по биоразнообразию (SaBC), Яясан Сабах (Фонд Сабаха), комитетам по управлению долиной Данум и бассейну Малиау, Глену Рейнольдсу и Партнерству по исследованию тропических лесов Юго-Восточной Азии (SEARRP), а также Робу Эверсу за поддержку и предоставление разрешения на доступ к полевым сайтам [SaBC Access License No. JKM / MBS.1000-2 / 2 JLD.3 (173)]. Мы чрезвычайно благодарны за поддержку Лауре Круитбос, Ундинг Джами и всем научным сотрудникам в Сабахе, без которых это исследование было бы невозможно.

Дополнительные материалы

Дополнительные материалы к этой статье можно найти в Интернете по адресу: https://www.frontiersin.org/articles/10.3389/ffgc.2020.00064/full#supplementary-material

Список литературы

Аллен, С. Э. (1989). Химический анализ экологических материалов, 2-е издание, Оксфорд; Лондон: Научные публикации Блэквелла.

Google Scholar

Андерсон, Дж. М., и Ингрэм, Дж. С. И. (1993). Биология и плодородие тропических почв: Справочник по методам , Уоллингфорд: CAB International.

Google Scholar

Аверилл К., Тернер Б. Л. и Финци А. С. (2014). Опосредованная микоризой конкуренция между растениями и деструкторами способствует накоплению углерода в почве. Природа 505, 543–545. DOI: 10.1038 / природа12901

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Бабикова, З., Гилберт, Л., Брюс, Т. Дж. А., Биркетт, М., Колфилд, Дж. К., Вудкок, К., и др. (2013). Подземные сигналы, передаваемые через общие мицелиальные сети, предупреждают соседние растения о нападении тли. Ecol. Lett. 16, 835–843. DOI: 10.1111 / ele.12115

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Баччини, А., Уокер, В., Карвалью, Л., Фарина, М., Сулла-Менаше, Д., и Хоутон, Р. А. (2017). Тропические леса являются чистым источником углерода, основанным на наземных измерениях прироста и потерь. Наука , 358: 230. DOI: 10.1126 / science.aam5962

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Бахрам, М., Пи, К.Г., Тедерсоо Л. (2015). Биогеография локального масштаба и пространственно-временная изменчивость сообществ микоризных грибов. New Phytol. 205, 1454–1463. DOI: 10.1111 / nph.13206

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Баккер, М., Делеру, Ф., Андреассон, Ф., Нгао, Дж., Данноура, М., Целлер, Б. и др. (2015). Рост гифов в сетчатых мешках для врастания в насаждениях fagus sylvatica, quercus petraea и pinus pinaster во франции. Eur. J. Soil Biol. 70, 111–117.DOI: 10.1016 / j.ejsobi.2015.08.003

CrossRef Полный текст | Google Scholar

Барберан, А., Макгуайр, К. Л., Вольф, Дж. А., Джонс, Ф. А., Райт, С. Дж., Тернер, Б. Л. и др. (2015). Связь подземного микробного состава с распределением таксономических, филогенетических и функциональных признаков деревьев в тропическом лесу. Ecol. Lett. 18, 1397–1405. DOI: 10.1111 / ele.12536

CrossRef Полный текст | Google Scholar

Барто, Э. К., Вайденхамер, Дж.Д., Чиполлини Д. и Риллиг М. С. (2012). Грибковые супермагистрали: улучшают ли обычные микоризные сети подземную коммуникацию? Trends Plant Sci. 17, 633–637. DOI: 10.1016 / j.tplants.2012.06.007

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Бейтс Д., Мехлер М., Болкер Б. и Уокер С. (2015). Подбор линейных моделей смешанных эффектов с использованием LME4. J. Statis. Софтв. 67, 1–48. DOI: 10.18637 / jss.v067.i01

CrossRef Полный текст | Google Scholar

Беррути, А., Дезиро, А., Визентин, С., Зекка, О., и Бонфанте, П. (2017). Праймеры, кодирующие штрих-кодирование грибов, в сравнении с праймерами, специфичными для 18S AMF, выявляют сходные паттерны разнообразия на основе AMF в корнях и почвах трех горных виноградников. Environ. Microbiol. Rep. 9, 658–667. DOI: 10.1111 / 1758-2229.12574

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Бевер, Дж. Д., Дики, И. А., Фаселли, Э., Фаселли, Дж. М., Клирономос, Дж., Мура, М. и др. (2010). Укоренение теории экологии растительного сообщества в микробных взаимодействиях. Trends Ecol. Evol. 25, 468–478. DOI: 10.1016 / j.tree.2010.05.004

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Боддингтон, К. Л., Бассет, Э. Э., Якобсен, И., и Додд, Дж. К. (1999). Сравнение методов экстракции и количественного определения экстрарадикального мицелия арбускулярных микоризных грибов в почвах. Soil Biol. Biochem. 31, 479–482. DOI: 10.1016 / S0038-0717 (98) 00145-X

CrossRef Полный текст | Google Scholar

Оба, С., Элиас, Д. М., Критцлер, У. Х., Остле, Н. Дж., И Джонсон, Д. (2017). Качество землепользования, а не подстилки, является более сильным фактором разложения в гиперразнообразных тропических лесах. Ecol. Evol. 7, 9307–9318. DOI: 10.1002 / ece3.3460

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Both, S., Riutta, T., Paine, C. E. T., Elias, D. M. O., Cruz, R. S., Jain, A., et al. (2019). Вырубка леса и содержание питательных веществ в почве независимо друг от друга объясняют проявление признаков растений в тропических лесах. New Phytol. 221: 1853. DOI: 10.1111 / nph.15444

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Брей Р. Х. и Курц Л. Т. (1945). Определение общего количества органических и доступных форм фосфора в почвах. Почвоведение. 59, 39–46. DOI: 10.1097 / 00010694-194501000-00006

CrossRef Полный текст | Google Scholar

Брирли, Ф.К. (2012). Эктомикоризные ассоциации диптерокарповых клеток. Biotropica , 44, 637–648.DOI: 10.1111 / j.1744-7429.2012.00862.x

CrossRef Полный текст | Google Scholar

Брайан, Дж. Э., Ширман, П. Л., Аснер, Г. П., Кнапп, Д. Э., Аоро, Г., и Локес, Б. (2013). Крайние различия в деградации лесов в Борнео: сравнение практик в сараваке, сабахе и брунее. PloS ONE 8: e69679. DOI: 10.1371 / journal.pone.0069679

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Бускардо, Э., Гемл, Дж., Шмидт, С., Фрейтас, Х., Да Кунья, Х., и Надь, Л. (2018). Пространственно-временная динамика почвенных бактериальных сообществ в зависимости от фенологии амазонских лесов. Sci. Отчет 8: 4382. DOI: 10.1038 / s41598-018-22380-z

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Кэрни, Дж. У. Г. (2012). Экстраматрический мицелий эктомикоризных грибов как модераторы углеродной динамики в лесной почве. Soil Biol. Biochem. 47, 198–208. DOI: 10.1016 / j.soilbio.2011.12.029

CrossRef Полный текст | Google Scholar

Каллахан, Б.Дж., Макмерди П. Дж., Розен М. Дж., Хан А. В., Джонсон А. Дж. А. и Холмс С. П. (2016). Dada2: вывод образца с высоким разрешением из данных ампликона иллюминации. Нат. Методы 13, 581–583. DOI: 10.1038 / nmeth.3869

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Камензинд, Т., Папатанасиу, Х. Дж., Форстер, А., Дитрих, К., Хертель, Д., Хомейер, Дж. И др. (2016). Увеличение агрегации почвы после добавления фосфора в тропическом премонтанном лесу не вызвано распространенностью корневых и арбускулярных микоризных грибов. Фронт. Earth Sci. 3:89. DOI: 10.3389 / feart.2015.00089

CrossRef Полный текст | Google Scholar

Чен В., Коиде Р. Т., Адамс Т. С., Дефорест Дж. Л., Ченг Л. и Эйссенстат Д. М. (2016). Морфология корней и микоризные симбиозы вместе формируют стратегии добычи питательных веществ деревьями умеренного пояса. Proc. Natl. Акад. Sci. США 113: 8741. DOI: 10.1073 / pnas.1601006113

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Клемменсен, К.Э., Финли, Р. Д., Дальберг, А., Стенлид, Дж., Уордл, Д. А., и Линдал, Б. Д. (2015). Связывание углерода связано со сдвигом микоризного грибкового сообщества во время длительной сукцессии в бореальных лесах. New Phytol. 205, 1525–1536. DOI: 10.1111 / Nph.13208

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Кортуа Р., Шредер-Георги Т., Вайгельт А., ван дер Путтен В. Х. и Де Дейн Г. Б. (2016). Обратная связь между растением и почвой: роль функциональной группы растений и их свойств. J. Ecol. 104, 1608–1617. DOI: 10.1111 / 1365-2745.12643

CrossRef Полный текст | Google Scholar

Дриго Б., Андерсон И. К., Каннангара Г. С. К., Кэрни Дж. У. Г. и Джонсон Д. (2012). Быстрое включение углерода из некромассы эктомикоризного мицелия в сообщества почвенных грибов. Soil Biol. Biochem. 49, 4–10. DOI: 10.1016 / j.soilbio.2012.02.003

CrossRef Полный текст | Google Scholar

Дюфрен, М., и Лежандр, П.(1997). Видовые сообщества и индикаторные виды: необходимость гибкого асимметричного подхода. Ecol. Monogr. 67, 345–366. DOI: 10.1890 / 0012-9615 (1997) 067 [0345: SAAIST] 2.0.CO; 2

CrossRef Полный текст | Google Scholar

Dupont, A. Ö. К., Гриффитс, Р. И., Белл, Т., и Басс, Д. (2016). Различия в почвенных микроэукариотических сообществах по градиентам почвенного pH в значительной степени обусловлены паразитами и сапротрофами. Environ. Microbiol. 18, 2010–2024. DOI: 10.1111 / 1462-2920.13220

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Дайкс, А. П. (1997). Перехват дождя из тропического леса низменности в брунее. J. Hydrol. 200, 260–279. DOI: 10.1016 / S0022-1694 (97) 00023-1

CrossRef Полный текст | Google Scholar

Эк, Х., Сьегрен, М., Арнебрант, К., и Седерстрём, Б. (1994). Экстраматрический рост мицелия, распределение биомассы и поглощение азота в эктомикоризных системах в ответ на выпас коллембол. Заявл. Soil Ecol. 1, 155–169. DOI: 10.1016 / 0929-1393 (94) -3

CrossRef Полный текст | Google Scholar

Экблад А., Валландер Х., Годболд Д., Круз К., Джонсон Д., Балдриан П. и др. (2013). Производство и круговорот внематрического мицелия эктомикоризных грибов в лесных почвах: роль в круговороте углерода. Растительная почва 366, 1–27. DOI: 10.1007 / s11104-013-1630-3

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Элиас, Д.М. О., Макнамара, Н. П., Остле, Н. Дж., И Маджалап-Ли, Н. (2018). Свойства почв в девственных лесах, вырубленных лесах и плантациях масличных пальм в Сабахе , Малайзия: Центр данных экологической информации NERC.

Google Scholar

Эммет, Б. А., Фрогбрук, З. Л., Чемберлен, П. М., Гриффитс, Р., Пикап, Р., Поскит, Дж. И др. (2008). Технический отчет исследования сельской местности № 03/07 . Доступно в Интернете по адресу: http://www.countrysidesurvey.org.uk/sites/default/files/CS_UK_2007_TR3%20-%20Soils%20Manual.pdf

Google Scholar

Эссен, А. Л., Шек, К. Л., Льюис, Дж. Д., Пи, К. Г., и Макгуайр, К. Л. (2017). Тип почвы играет более сильную роль, чем виды-хозяева диптерокарпов, в формировании сообщества эктомикоризных грибов в тропических лесах низменности Борноборья. Фронт. Plant Sci. 8: 1828. DOI: 10.3389 / fpls.2017.01828

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Эверс, Р. М., Дидхэм, Р. К., Фариг, Л., Ферраз, Г., Гектор, А., Холт, Р.D., et al. (2011). Крупномасштабный эксперимент по фрагментации леса: проект «Стабильность измененных лесных экосистем». Philos. Пер. Рой. Soc. B 366, 3292–3302. DOI: 10.1098 / rstb.2011.0049

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Финли Р. Д. (2008). Экологические аспекты микоризного симбиоза: особое внимание уделяется функциональному разнообразию взаимодействий с участием экстрарадикального мицелия. J. Exp. Бот. 59, 1115–1126. DOI: 10.1093 / jxb / ern059

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Фишер Б., Эдвардс Д. П., Джиам X. и Уилков Д. С. (2011). Высокая стоимость сохранения тропических лесов низменностей Юго-Восточной Азии. Фронт. Ecol. Environ. 9:79. DOI: 10.1890 / 100079

CrossRef Полный текст | Google Scholar

Фишер Дж., Малхи Ю., Торрес И., Меткалф Д., Ван Де Вег М., Меир П. и др. (2013). Ограничение питательных веществ в тропических лесах и облачных лесах на высоте 3000 м в перуанских андах. Oecologia 172, 889–902. DOI: 10.1007 / s00442-012-2522-6

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Фитцхерберт, Э. Б., Струбиг, М. Дж., Морель, А., Даниэльсен, Ф., Брюль, К. А., Дональд, П. Ф. и др. (2008). Как распространение масличной пальмы повлияет на биоразнообразие? Trends Ecol. Evol. 23, 538–545. DOI: 10.1016 / j.tree.2008.06.012

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Гаво, Д. Л., Шейл, Д., Husnayaen, S. M. A., Arjasakusuma, S., Ancrenaz, M., Pacheco, P., et al. (2016). Быстрые преобразования и предотвращение вырубки лесов: анализ четырех десятилетий расширения промышленных плантаций в Борнео. Sci. Отчет 6: 32017. DOI: 10.1038 / srep32017

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Гаво, Д. Л., Слоан, С., Молидена, Э., Яен, Х., Шейл, Д., Абрам, Н. К. и др. (2014). Четыре десятилетия сохранения леса, вырубки и вырубки леса на борнео. PloS ONE 9: e101654.DOI: 10.1371 / journal.pone.0101654

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Горзелак М. А., Асаи А. К., Пиклз Б. Дж. И Симард С. В. (2015). Связь между растениями через микоризные сети опосредует сложное адаптивное поведение в растительных сообществах. Заводы AoB 7: plv050. DOI: 10.1093 / aobpla / plv050

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Хагенбо, А., Кященко, Дж., Клемменсен, К. Э., Линдаль, Б.Д., и Франссон, П. (2018). Сдвиги грибкового сообщества лежат в основе снижения производства и оборота мицелия в хронопоследовательности сосны обыкновенной. J. Ecol. 106, 490–501. DOI: 10.1111 / 1365-2745.12917

CrossRef Полный текст | Google Scholar

Хагерберг Д., Телин Г. и Валландер Х. (2003). Производство эктомикоризного мицелия в лесах: взаимосвязь между питательным статусом леса и местными минеральными источниками. Растительная почва 252, 279–290. DOI: 10.1023 / А: 1024719607740

CrossRef Полный текст | Google Scholar

Хансен, М. К., Потапов, П. В., Мур, Р., Ханчер, М., Турубанова, С. А., Тюкавина, А. и др. (2013). Глобальные карты изменения лесного покрова в XXI веке в высоком разрешении. Наука 342: 850. DOI: 10.1126 / science.1244693

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Ханссен, Дж. Ф., Тингстад, Т. Ф., и Гоксойр, Дж. (1974). Оценка длины гиф и грибной биомассы в почве методом мембранной фильтрации. Oikos , 25, 102–107. DOI: 10.2307 / 3543552

CrossRef Полный текст | Google Scholar

Харт М. М., Алеклетт К., Шаньон П. Л., Иган К., Гиньон С., Хельгасон Т. и др. (2015). Путешествие по лабиринту: руководство по экологии сообществ арбускулярных микоризных грибов на основе последовательностей. New Phytol. 207, 235–247. DOI: 10.1111 / Nph.13340

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Хартманн, М., Никлаус, П.А., Циммерманн, С., Schmutz, S., Kremer, J., Abarenkov, K., et al. (2013). Устойчивость и устойчивость микробиома лесной почвы к уплотнению при лесозаготовках. ISME J. 8, 226–244. DOI: 10.1038 / ismej.2013.141

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Hazebroek, H.P., Adlin, T.Z., and Sinun, W. (2004). Бассейн Малиау: Затерянный мир Сабаха 903 13. Кота-Кинабалу: публикации по естественной истории (Борнео).

Google Scholar

Ихрмарк, К., Bodeker, I. T. M., Cruz-Martinez, K., Friberg, H., Kubartova, A., Schenck, J., et al. (2012). Новые праймеры для амплификации области its2 гриба - оценка с помощью 454-секвенирования искусственных и естественных сообществ. FEMS Microbiol. Ecol. 82, 666–677. DOI: 10.1111 / j.1574-6941.2012.01437.x

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Итиока, Т., и Ямаути, М. (2004). Сильная засуха, фенология листвы, повреждение листьев и обилие чешуекрылых в пологе сезонного тропического леса. J. Trop. Ecol. 20, 479–482. DOI: 10.1017 / S0266467404001658

CrossRef Полный текст | Google Scholar

Ито З., Реши З. (2013). Многофункциональная роль эктомикоризных ассоциаций в процессах лесных экосистем. Бот. Ред. 79, 371–400. DOI: 10.1007 / s12229-013-9126-7

CrossRef Полный текст | Google Scholar

Джонсон, Д., Лик, Дж. Р., Остле, Н., Инесон, П., и Рид, Д. Дж. (2002). In situ Импульсное мечение 13CO2 высокогорных пастбищ демонстрирует быстрый путь потока углерода от арбускулярного микоризного мицелия в почву. New Phytol. 153, 327–334. DOI: 10.1046 / j.0028-646X.2001.00316.x

CrossRef Полный текст | Google Scholar

Керфахи Д., Трипати Б. М., Ли Дж., Эдвардс Д. П. и Адамс Дж. М. (2014). влияние выборочных рубок и вырубки масличных пальм на грибные сообщества в Борнео. PLoS ONE 9: e111525. DOI: 10.1371 / journal.pone.0111525

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Kjøller, R. (2006). Непропорционально большое количество кончиков эктомикоризных корней и связанных с ними мицелий. FEMS Microbiol. Ecol. 58, 214–224. DOI: 10.1111 / j.1574-6941.2006.00166.x

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Козич, Дж. Дж., Весткотт, С. Л., Бакстер, Н. Т., Хайлендер, С. К., и Шлосс, П. Д. (2013). Разработка стратегии двухиндексного секвенирования и конвейера курирования для анализа данных последовательности ампликонов на платформе секвенирования miseq illumina. Заявл. Environ. Microbiol. 79, 5112–5120. DOI: 10.1128 / AEM.01043-13

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Кумагаи, Т.О., Порпорато А. (2012). Смертность в тропических лесах, вызванная засухой, усиливается из-за изменения климата. J. Geophys. Res: Biogeosci. 117: G02032. DOI: 10.1029 / 2011JG001835

CrossRef Полный текст | Google Scholar

Кумагаи Т.О., Сайто Т.М., Сато Ю., Такахаши Х., Манфрой О.Дж., Мороока Т. и др. (2005). Годовой водный баланс и сезонность эвапотранспирации в прибрежных тропических лесах. Agric. Forest Meteorol. 128, 81–92.DOI: 10.1016 / j.agrformet.2004.08.006

CrossRef Полный текст | Google Scholar

Ламберс, Х., Рэйвен, Дж. А., Шейвер, Г. Р., и Смит, С. Е. (2008). Стратегии усвоения питательных веществ растениями меняются с возрастом почвы. Trends Ecol Evol. 23, 95–103. DOI: 10.1016 / j.tree.2007.10.008

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Лэндон, Дж. Р. (1984). Букерское руководство по тропическим почвам: Руководство по обследованию почв и оценке сельскохозяйственных земель в тропиках и субтропиках , Лондон: Букерское сельское хозяйство Интернэшнл.

Google Scholar

Ли-Круз, Л., Эдвардс, Д. П., Трипати, Б. М., и Адамс, Дж. М. (2013). Влияние рубок и преобразования лесов в плантации масличных пальм на бактериальные сообщества почвы в Борнео. Заявл. Environ. Microbiol. 79, 7290–7297. DOI: 10.1128 / AEM.02541-13

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Лежандр, П., и Боркар, Д. (2018). Преобразования Box-Cox-Chord для данных о составе сообщества до анализа бета-разнообразия. Экография 41, 1820–1824. DOI: 10.1111 / ecog.03498

CrossRef Полный текст | Google Scholar

Лекберг, Ю., Вазар, М., Буллингтон, Л. С., Сепп, С. К., Антунес, П. М., Банн, Р. и др. (2018). Больше отдачи? Можно ли адекватно охарактеризовать сообщества арбускулярных микоризных грибов наряду с другими грибами с помощью общих грибковых праймеров? Новый Фитол. 220, 971–976. DOI: 10.1111 / nph.15035

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Леннон, Дж.T., Muscarella, M.E., Placella, S.A., и Lehmkuhl, B.K. (2018). Как, когда и где реликтовая ДНК влияет на микробное разнообразие. мБио 9: e00637-18. DOI: 10.1128 / mBio.00637-18

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Линдал, Б. Д., Ихрмарк, К., Боберг, Дж., Трумбор, С. Э., Хёгберг, П., Стенлид, Дж. И др. (2007). Пространственное разделение разложения подстилки и микоризного поглощения азота в бореальном лесу. New Phytol. 173, 611–620.DOI: 10.1111 / j.1469-8137.2006.01936.x

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Лю X., Бурслем Д. Ф. Р. П., Тейлор Д. Д., Тейлор А. Ф. С., Ху Э., Маджалап-Ли Н. и др. (2018). Распределение почвенного фосфора между арбускулярными и эктомикоризными деревьями в тропических и субтропических лесах. Ecol. Lett. 21, 713–723. DOI: 10.1111 / ele.12939

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Майди, Х., Труус, Л., Йоханссон, У., Нюлунд, Дж.-Э., Уолландер, Х. (2008). Влияние удержания косой черты и добавления древесной золы на мелкую корневую биомассу и продукцию, а также на грибной мицелий еловых насаждений норвегской в ​​Юго-Восточной Швеции. Forest Ecol. Manag. 255, 2109–2117. DOI: 10.1016 / j.foreco.2007.12.017

CrossRef Полный текст | Google Scholar

Малхи, Ю., Даути, К. Э., Голдсмит, Г. Р., Меткалф, Д. Б., Жирардин, К. А. Дж., Мартюз, Т. Р. и др. (2015). Связь между фотосинтезом, продуктивностью, ростом и биомассой в низинных лесах Амазонки. Glob. Сменить Биол. 21, 2283–2295. DOI: 10.1111 / gcb.12859

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Марш, К. В., и Грир, А. Г. (1992). Использование лесных земель в сабахе, малайзия: знакомство с долиной данум. Philos. Пер. Рой. Soc. B Biol. Sci. 335, 331–339. DOI: 10.1098 / rstb.1992.0025

CrossRef Полный текст | Google Scholar

Marthews, T., Riutta, T., Oliveras Menor, I., Urrutia, R., Moore, S., Metcalfe, D., и другие. (2014). Измерение распределения и цикла углерода в тропических лесах: Полевое руководство RAINFOR-GEM для участков интенсивной переписи (версия 3.0). Руководство, Сеть глобального мониторинга экосистем . Доступно в Интернете по адресу: https://gem.tropicalforests.ox.ac.uk

Google Scholar

Макгуайр, К., Д'Анджело, Х., Брирли, Ф., Гедаллович, С., Бабар, Н., Янг, Н. и др. (2015). Реакция почвенных грибов на лесозаготовки и выращивание масличных пальм в тропических лесах Юго-Восточной Азии. Microb.Ecol. 69, 733–747. DOI: 10.1007 / s00248-014-0468-4

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Макгуайр, К., Хенкель, Т., Гранцов де ла Серда, И., Вилья, Г., Эдмунд, Ф., и Эндрю, К. (2008). Двойная микоризная колонизация лесных доминирующих тропических деревьев и микоризный статус недоминантных видов деревьев и лиан. Микориза 18, 217–222. DOI: 10.1007 / s00572-008-0170-9

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Макмурди, П.Дж. И Холмс С. (2013). Phyloseq: пакет r для воспроизводимого интерактивного анализа и графики данных переписи микробиома. PLoS ONE 8: e61217. DOI: 10.1371 / journal.pone.0061217

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Миллер У. П. и Миллер Д. М. (1987). Метод микропипеток для механического анализа почвы. Commun. Почвоведение. Завод анальный. 18, 1–15. DOI: 10.1080 / 00103628709367799

CrossRef Полный текст | Google Scholar

Мюллер Р.К., Родригес, Дж. Л. М., Нюсслейн, К., и Боханнан, Б. Дж. М. (2016). Изменения в землепользовании в тропических лесах Амазонки благоприятствуют распространению грибов. Func. Ecol. 30, 1845–1853. DOI: 10.1111 / 1365-2435.12651

CrossRef Полный текст | Google Scholar

Майерс, Н., Миттермайер, Р. А., Миттермайер, К. Г., Да Фонсека, Г. А., и Кент, Дж. (2000). Горячие точки биоразнообразия для сохранения приоритетов. Природа , 403: 853. DOI: 10.1038 / 35002501

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Насто, М.К., Альварес-Клэр, С., Лекберг, Ю., Салливан, Б. В., Таунсенд, А. Р., Кливленд, К. С. (2014). Взаимодействие между азотфиксацией и стратегиями поглощения почвенного фосфора в тропических лесах равнинных районов. Ecol. Lett. 17, 1282–1289. DOI: 10.1111 / ele.12335

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Нгуен Н. Х., Сонг З., Бейтс С. Т., Бранко С., Тедерсоо Л., Менке Дж. И др. (2016). Funguild: открытый инструмент аннотации для анализа наборов данных грибных сообществ экологической гильдией. Fungal Ecol. 20, 241–248. DOI: 10.1016 / j.funeco.2015.06.006

CrossRef Полный текст | Google Scholar

Нильссон, Л. О., и Валландер, Х. (2003). Продукция внешнего мицелия эктомикоризными грибами в ельнике норвежском была снижена в ответ на азотные удобрения. New Phytol. 158, 409–416. DOI: 10.1046 / j.1469-8137.2003.00728.x

CrossRef Полный текст | Google Scholar

Ноттингем, А. Т., Тернер, Б. Л., Винтер, К., Чемберлен П. М., Стотт А. и Таннер Э. В. Дж. (2013). Взаимодействие корневого и арбускулярного микоризного мицелия с почвенными микроорганизмами в низинных тропических лесах. FEMS Microbiol. Ecol. 85, 37–50. DOI: 10.1111 / 1574-6941.12096

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Оксанен, Дж., Бланше, Ф. Г., Киндт, Р., Лежандр, П., О'Хара, Р. Б., Симпсон, Г. Л. и др. (2019). Веган: Пакет «Экология сообщества» . Доступно в Интернете по адресу: https: // cran.r-project.org/package=vegan

Google Scholar

Орвин, К. Х., Киршбаум, М. У. Ф., Сент-Джон, М. Г., и Дики, И. А. (2011). Поглощение органических питательных веществ микоризными грибами увеличивает запасы углерода в экосистеме: оценка на основе моделей. Ecol. Lett. 14, 493–502. DOI: 10.1111 / j.1461-0248.2011.01611.x

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Пан Ю., Бердси Р. А., Фанг Дж., Хоутон Р., Кауппи П. Э., Курц В. А. и др.(2011). Большой и устойчивый сток углерода в лесах мира. Science 333, 988–993. DOI: 10.1126 / science.1201609

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Фосри К., Родригес А., Сандерс И. Р. и Джеффрис П. (2010). Роль микоризы в более устойчивом выращивании масличных пальм. Agric. Экосист. Environ. 135, 187–193. DOI: 10.1016 / j.agee.2009.09.006

CrossRef Полный текст | Google Scholar

Потила, Х., Валландер, Х., Сарджала, Т. (2009). Рост эктомикоризных грибов в осушенных торфяниках с переменной доступностью p и k. Внутр. J. Plant Soil Relat. 316, 139–150. DOI: 10.1007 / s11104-008-9766-2

CrossRef Полный текст | Google Scholar

Пауэрс Р. П. и Джетц В. (2019). Глобальная потеря среды обитания и риск исчезновения наземных позвоночных при будущих сценариях изменения землепользования. Нат. Клим. Изменить 9, 323–329. DOI: 10.1038 / s41558-019-0406-z

CrossRef Полный текст | Google Scholar

R Основная команда (2013). R: язык и среда для статистических вычислений. R Фонд статистических вычислений, Вена, Австрия . Доступно в Интернете по адресу: http://www.r-project.org/

Google Scholar

Ричардс П. В. (1996). Тропический дождевой лес: экологическое исследование , Кембридж: Издательство Кембриджского университета.

Google Scholar

Риллиг, М. К., Агилар-Тригуэрос, К. А., Бергманн, Дж., Вербрюгген, Э., Вересоглу, С. Д., и Леманн, А. (2015).Свойства корней растений и микоризных грибов для понимания агрегации почвы. New Phytol. 174, 1385–1388. DOI: 10.1111 / Nph.13045

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Рютта, Т., Малхи, Ю., Хо, Л. К., Мартюз, Т. Р., Уарака, Уаско, В., Ху, М., и др. (2018). Нарушение лесозаготовок изменяет чистую первичную продуктивность и ее распределение в прилегающих тропических лесах. Glob. Сменить Биол. 24, 2913–2928. DOI: 10.1111 / gcb.14068

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Setäl, ä, H., Кульмала, П., Микола, Дж., И Марккола, А. М. (1999). Влияние эктомикоризы на структуру детритных пищевых сетей в ризосфере сосны. Oikos , 87, 113–122. DOI: 10.2307 / 3547002

CrossRef Полный текст | Google Scholar

Шен, К., Киршбаум, М. У. Ф., Хедли, М. Дж., И Кэмпс Арбестейн, М. (2016). Тестирование альтернативного метода оценки длины гиф грибов с использованием микрофотографии и обработки изображений. PLoS ONE 11: e0157017. DOI: 10.1371 / journal.pone.0157017

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Смит, С. Э., и Рид, Д. Дж. (2008). Микоризный симбиоз, Амстердам; Лондон: Академ.

Google Scholar

Sodhi, N. S., Koh, L. P., Clements, R., Wanger, T. C., Hill, J. K., Hamer, K. C., et al. (2010). Сохранение биоразнообразия лесов Юго-Восточной Азии в измененных человеком ландшафтах. Biol. Консерв. 143, 2375–2384. DOI: 10.1016 / j.biocon.2009.12.029

CrossRef Полный текст | Google Scholar

Тейлор, А. Ф. С., и Александер, И. (2005). Эктомикоризный симбиоз: жизнь в реальном мире. Миколог 19, 102–112. DOI: 10.1017 / S0269-915X (05) 00303-4

CrossRef Полный текст | Google Scholar

Теннант Д. (1975). Тест модифицированного метода пересечения линий для оценки длины корня. J. Ecol. 63, 995–1001. DOI: 10.2307 / 2258617

CrossRef Полный текст | Google Scholar

Трипати, Б.М., Эдвардс, Д. П., Мендес, Л. В., Ким, М., Донг, К., Ким, Х., и Адамс, Дж. М. (2016). влияние вырубки тропических лесов и выращивания масличных пальм на микробиом почвы. Мол. Ecol. 25, 2244–2257. DOI: 10.1111 / mec.13620

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Сообщество UNITE (2017). UNITE General Fasta Release. Версия 01.12.2017.

Google Scholar

ван дер Хейден, М. Г. А., Барджетт, Р. Д., и ван Страален, Н.М. (2008). Незримое большинство: почвенные микробы как движущие силы разнообразия растений и продуктивности наземных экосистем. Ecol. Lett. 11, 296–310. DOI: 10.1111 / j.1461-0248.2007.01139.x

PubMed Аннотация | CrossRef Полный текст | Google Scholar

van der Putten, W., Bardgett, R.D., Bever, J.D., Bezemer, T.M., Casper, B., Fukami, T., et al. (2013). Обратная связь между растениями и почвами: прошлое, настоящее и будущее. J. Ecol. 101, 265–276. DOI: 10.1111 / 1365-2745.12054

CrossRef Полный текст | Google Scholar

Валландер, Х., Экблад, А., Годболд, Д. Л., Джонсон, Д., Бахр, А., Балдриан, П. и др. (2013). Оценка методов оценки продукции, биомассы и круговорота эктомикоризного мицелия в лесных почвах - обзор. Soil Biol. Biochem. 57, 1034–1047. DOI: 10.1016 / j.soilbio.2012.08.027

CrossRef Полный текст | Google Scholar

Валландер, Х., Нильссон, Л.О., Хагерберг, Д., и Båth, E. (2001). Оценка биомассы и сезонного роста внешнего мицелия эктомикоризных грибов в полевых условиях. New Phytol. 151, 753–760. DOI: 10.1046 / j.0028-646x.2001.00199.x

CrossRef Полный текст | Google Scholar

Уолш Р. П. и Ньюбери Д. М. (1999). Экоклиматология данума, сабаха в контексте тропических лесов мира, с особым упором на засушливые периоды и их влияние. Philos. Пер. Рой. Soc. B Biol.Sci. 354, 1869–1883. DOI: 10.1098 / rstb.1999.0528

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Уордл Д., Барджетт Р. Д., Клирономос Дж., Сетала Х., ван дер Путтен В. и Уолл Д. (2004). Экологические связи между наземной и подземной биотой. Sci. 304, 1629–1633. DOI: 10.1126 / science.1094875

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Уикхэм, Х. (2016). ggplot2: Элегантная графика для анализа данных , Нью-Йорк, Нью-Йорк: Springer-Verlag.DOI: 10.1007 / 978-3-319-24277-4_9

CrossRef Полный текст | Google Scholar

Уилков, Д. С., Джиам, X., Эдвардс, Д. П., Фишер, Б., и Кох, Л. П. (2013). Возвращение к кошмару Навджота: лесозаготовки, сельское хозяйство и биоразнообразие в юго-восточной азии. Trends Ecol. Evol. 28, 531–540. DOI: 10.1016 / j.tree.2013.04.005

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Уилсон, Дж. У. Т., Райс, К. У., Риллиг, М. К., Спрингер, А., и Хартнетт, Д.С. (2009). Агрегация почвы и связывание углерода тесно связаны с численностью арбускулярных микоризных грибов: результаты длительных полевых экспериментов. Ecol. Lett. 12, 452–461. DOI: 10.1111 / j.1461-0248.2009.01303.x

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Вюрцбургер Н., Клемменсен К. Э. (2018). От микоризных грибов до свойств экосистемы - и обратно. J. Ecol. 106, 463–467. DOI: 10.1111 / 1365-2745.12922

CrossRef Полный текст | Google Scholar

Зак, Д. Р., Пеллитье, П. Т., Аргирофф, В., Кастильо, Б., Джеймс, Т. Ю., Нейв, Л. Е. и др. (2019). Изучение роли эктомикоризных грибов в динамике углерода почвы. New Phytol. 223, 33–39. DOI: 10.1111 / nph.15679

PubMed Аннотация | CrossRef Полный текст | Google Scholar

Характеристики почвы на полях, выращивающих биотопливо, влияют на ее способность накапливать углерод

The Science

Большая часть углерода, содержащегося в почве, находится в форме органического вещества.Состав этого вещества определяют растения, микробы и почва. Однако ученые не до конца понимают, как вариации в составе растений, структура микробных сообществ, а также физические и химические свойства почвы взаимодействуют, чтобы влиять на химический состав органических веществ в почве. Исследователи устранили этот пробел в знаниях, соединив микробные характеристики с подробным химическим составом почвы из двух долгосрочных биоэнергетических исследовательских экспериментов. Они обнаружили, что почва на полях просеянных трав содержит больше водорастворимых соединений углерода, чем почва на кукурузных полях.Однако текстура почвы была более важной, чем тип культуры, на состав микробного сообщества почвы и химический состав почвенного органического вещества.

The Impact

Растения берут углерод из воздуха, строят клетки, а затем выделяют часть углерода в почву через корни и корневые экссудаты. Некоторые исследователи предположили, что выращивание биотопливных культур на маргинальных почвах, которые обычно имеют низкое содержание углерода, может быть способом удаления углерода из атмосферы и хранения его под землей.Одна из проблем - найти растения, которые могут расти на этих некачественных почвах. В этих условиях могут выжить многолетние травы, такие как просо. Однако это новое исследование ставит под сомнение представление о том, что просо увеличивает накопление углерода в поверхностных почвах маргинальных земель.

Резюме

Ученые должны понимать механизмы контроля за накоплением органических веществ в почве, чтобы определить стратегии управления земельными ресурсами, которые улучшают здоровье почвы и увеличивают накопление углерода. Это включает стратегии для потенциальных культур биотоплива.Хотя исследователи знают, что более 50 процентов почвенного органического вещества имеет микробное происхождение, мы не до конца понимаем взаимосвязь между растениями, почвенными микроорганизмами и химией почвенного органического вещества.

В этом исследовании исследователи охарактеризовали влияние сельскохозяйственных культур и участков на структуру грибковых и бактериальных сообществ, потенциальную активность ферментов, химический состав углерода почвы и общие концентрации углерода и азота в почве в двух долгосрочных полевых экспериментах с биотопливом. На двух участках выращивались как кукуруза, так и просо.На одном участке преобладала супесчаная почва, на другом - илистая суглинистая почва. Исследование показало, что система земледелия меньше влияла на структуру микробного сообщества почвы и химию органического вещества, чем тип почвы. Тип почвы особенно повлиял на структуру грибного сообщества и химический состав относительно стойкого углерода. После восьми лет применения нулевой обработки почвы в илистых суглинках по-прежнему содержалось в два раза больше углерода и азота, чем в супесчаных почвах, без существенной реакции на использование биотопливной системы земледелия.Исследователи пришли к выводу, что это, вероятно, связано с повышенной микробной активностью в поверхностных почвах системы многолетних культур. В совокупности эти результаты демонстрируют, что первоначальный выбор участка имеет решающее значение для взаимодействия растений и микробов и существенно влияет на потенциал долгосрочного удержания углерода в поверхностных почвах при производстве биотоплива.

Контакт

Кирстен Хофмокель
Тихоокеанская северо-западная национальная лаборатория
[email protected]

Кристофер Касанке
Тихоокеанская северо-западная национальная лаборатория
Кристофер[email protected]

Финансирование

Это исследование было поддержано Кирстен С. Хофмокель и Центром биоэнергетических исследований Великих озер. Оба финансируются Управлением науки, биологических и экологических исследований Министерства энергетики (DOE), программой геномных наук. Часть этой работы была выполнена в Лаборатории молекулярных наук об окружающей среде Уильяма Р. Вили, расположенной в Тихоокеанской северо-западной национальной лаборатории. Поддержка этого исследования была также предоставлена ​​Программой долгосрочных экологических исследований Национального научного фонда на биологической станции Келлог и Университетом штата Мичиган AgBioResearch.

Публикации

Kasanke, C.P. et al. , Может ли просо увеличить накопление углерода в маргинальных почвах? Важность выбора места. Биология глобальных изменений - биоэнергетика (2020). [DOI: 10.1111 / gcbb.12777]

Характеристики почвы, определяющие сообщества арбускулярных микоризных грибов в полузасушливых средиземноморских почвах

Мы исследовали сообщества арбускулярных микоризных грибов (АМГ) в корнях и ризосферной почве Brachypodium retusum в шести различных естественных почвах в полевых условиях.Мы исследовали филогенетические закономерности состава AMF, используя анализ видов-индикаторов, чтобы найти AMF, связанный с данной средой обитания (корень в сравнении с ризосферой) или типом почвы. Мы проверили, связаны ли характеристики AMF различных местообитаний или контрастных почв более тесно, чем ожидалось случайно. Затем мы использовали анализ главных компонентов и многомерный дисперсионный анализ, чтобы проверить относительный вклад каждого фактора в объяснение вариаций в составе грибного сообщества. Наконец, мы использовали анализ избыточности, чтобы определить свойства почвы, которые в значительной степени объяснили различия в сообществах AMF по типам почвы.Результаты указали на тенденцию сообществ AMF в корнях быть тесно связанными и отличными от сообществ в ризосферной почве. Анализ видов-индикаторов выявил АМП, связанный с ризосферной почвой и корневой средой обитания. Тип почвы также определяет распределение сообществ AMF в почвах, и этот эффект нельзя отнести к одной характеристике почвы, поскольку по крайней мере три свойства почвы связаны с микробной активностью, то есть pH и уровни двух питательных микроэлементов (Mn и Zn), сыграли важную роль в запуске популяций AMF.

Важность: Сообщества арбускулярных микоризных грибов (AMF) являются основными компонентами почвенной биоты, которые могут определять продуктивность экосистем. Эти грибковые сообщества различаются в зависимости от растений-хозяев и экосистем, но основные экологические процессы, которые формируют структуры этих сообществ, все еще в значительной степени неизвестны. Полевое исследование шести различных типов почв из полузасушливых районов показало, что на сообщества AMF значительно влияют среда обитания (почва по сравнению с корнями) и тип почвы.Кроме того, три свойства почвы, связанные с микробиологической активностью (т.е. pH и уровни марганца и цинка), были основными факторами, запускающими распространение AMF. Эти результаты способствуют лучшему пониманию экологических факторов, которые могут формировать сообщества AMF, важную группу почвенных микробов, которая влияет на множество функций экосистемы.

.

Ответить

Ваш адрес email не будет опубликован. Обязательные поля помечены *